1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
3 years ago
10

Why is color a useful property for identifying malachite, but not quartz?

Biology
2 answers:
natulia [17]3 years ago
6 0

Answer:

Quartz can come in many different colors and shapes idk about malachite but i know that about quartz!

Explanation:

Hatshy [7]3 years ago
6 0

Answer:

Streak is a more reliable property than color because streak does not vary. Minerals that are the same color may have a different colored streak. Many minerals, such as the quartz in the Figure above, do not have streak. ... The streak of hematite across an unglazed porcelain plate is red-brown. Malachite (MAL-uh-KYT), an ore of copper, is green. Color, however, is the least useful property for mineral identification. One reason is that many minerals have similar colors. ... Another reason not to rely on color alone is that some minerals can change color in various circumstances.

hope this helps!!!!!!!!!! Can I have brainilist pls thx :)

You might be interested in
Which is an innovation of gymnosperms?
malfutka [58]

note:

Gymnosperms possess several key evolutionary innovations compared to earlier groups such as the clubmosses and ferns. They produce sperm-containing pollen, which is carried through the air by the wind to the female. This innovation has freed these plants from the need for water for sexual reproduction.

6 0
3 years ago
Read 2 more answers
PLZZZ HELPPP<br> Explain how rocks can be analyzed to determine the history of an area.
larisa [96]

Answer:

Well let's take Sedimentary rock for example, The Law of Superposition which measures the average age of Sedimentary rocks using rocks around it. So you would use that rocks below it are older and that Extrusions and Intrusions are younger than the rocks which are stable.

Explanation: Hope it Helps With Your Work!

6 0
3 years ago
Non-steroidal hormones can be produced by all of the following except the
ludmilkaskok [199]

Answer: its b i just got done with it

Explanation:

4 0
2 years ago
List at least four reasons why it is difficult to send manned space flights to parts
icang [17]
1 you run out of fuel 2 it takes a long time 3 it’s hard to get back 4 the conditions are constantly changing making it harder to predict what could happen. Look at Apollo 12 as a example
3 0
3 years ago
Other name for blood
EleoNora [17]
Hémoglobin =other name for blood
4 0
3 years ago
Read 2 more answers
Other questions:
  • New ecosystems have been created by human land use. Please select the best answer from the choices provided T F
    8·2 answers
  • Part 4: Sex-Linked Inheritance—Predicting Color Blindness in Offspring
    13·2 answers
  • Which taxonomic domain includes multicellular photosynthetic organisms? See concept 1.2 (page 12)?
    14·1 answer
  • Which of the following has mechanical energy? bouncing ball water in a reservoir book on a table person running falling tree
    7·2 answers
  • How do animals in the surface zone keep from sinking?
    14·1 answer
  • Which of the following statements is true?
    9·1 answer
  • As liquid water freezes, the molecules arrange themselves in a way that takes up more space than liquid water. What would most l
    7·2 answers
  • How does science help society?
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • True or False? : To measure the liquid in a graduated cylinder, you should read the top of the meniscus.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!