1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
14

How does a decrease in biodiversity impact an ecosystem?

Biology
2 answers:
lidiya [134]3 years ago
6 0
Biodiversity is essential to an ecosystem's resistance against viruses and famine. In history, there has been many cases in which a lack of biodiversity has allowed a virus or disease to endemically wipe out an entire species of plant. This will subsequently affect all consumers of each trophic level. Ex: A disease that attacks the DNA of only one certain species of plant would cause decreases in the population of the organisms that rely on eating that plant, the organisms that rely on eating those organisms, and so on. This is caused by a decrease in food source, thus not being able to sustain the ecosystem's demand, thus naturally killing off any organisms that would not be able to find a sufficient food source.
Nitella [24]3 years ago
4 0

A decrease in biodiversity would create an imbalance in the particular type of species present in an ecosystem.

Further Explanation:

An ecosystem is an interconnected system where <u>each and every type of organism depends on the other type of organism for its survival</u>. The decrease in biodiversity means that there is less number of species which is further decreasing in population due to various environmental impacts. The change in one type of organism affects the other type of organism which depends on it for survival. <u>The predators keep the ecosystem in a balanced state but the loss of predators increases the population of preys which affects the stability of ecosystem. </u>

The biodiversity of species is due to evolutionary process where each and every organism contributes or dependent of others.When there is greater biodiversity, changes in one type of organism will not impact the entire ecosystem whereas, less biodiversity affects each and every organism in the food chain.

Learn more:

1. Learn more about carbon dioxide brainly.com/question/1213217

2. Learn more about atmosphere brainly.com/question/2037060

3. Learn more about temperature brainly.com/question/1403211

Answer Details:

Grade: High School

Subject: Biology

Chapter: Ecology

Keywords:

Biodiversity, evolution, ecosystem, predators, evolutionary process, preys, food chain, interconnected system, population, species.

You might be interested in
Human skin color varies widely around the world, and children do not always exhibit the exact same coloring as their parents. Ba
tamaranim1 [39]
I'm not really sure, but I guess skin colour isn't passed genetically?
8 0
2 years ago
Read 2 more answers
The antibiotic penicillin is isolated from
kykrilka [37]

The antibiotic penicillin is isolated from <u><em>Penicillium notatum</em></u> fungi

Penicillin was first discovered in 1928 and was used at St. Mary's Hospital, London, by Alexander Fleming to heal wounds due to its antibacterial properties.

Explanation:

Fungi and bacteria usually produce antibiotics (as secondary metabolites) for defense mechanism. They do so to limit competition for resources with other neighboring fungi or bacteria in their environment.  This is why when a fungus or bacteria establishes itself in an environment, you hardly see other fungi or bacteria types growing in their vicinity.

Learn More:

For more on antibiotics check out;

brainly.com/question/10320882

brainly.com/question/9202583

#LearnWithBrainly

4 0
3 years ago
On which part of the compound light microscope are specimens placed for viewing?
julia-pushkina [17]

Answer: D

Explanation:

6 0
3 years ago
Read 2 more answers
Earth has a feedback mechanism that works between the surface of the Earth and its atmosphere. Which of the statements is not co
Mumz [18]
The appropriate answer is doing. decreased atmospheric water vapor leads to an increased greenhouse effect. This is not true because water vapor is a green house gas and increasing the levels of it in the atmosphere will lead to more warming. All the other answers represent appropriate feedback mechanisms associated with global warming.
6 0
3 years ago
In figure 32-3 a muscle that moves food through your digestive system is shown in
Levart [38]
<h3><u>Answer;</u></h3>

B

<h3><u>Explanation;</u></h3>
  • B are smooth muscles.
  • Smooth muscle is found in the walls of hollow organs throughout the body.
  • Smooth muscle contractions are involuntary movements triggered by impulses that travel through the autonomic nervous system to the smooth muscle tissue.
  • <u>The smooth muscle of the alimentary canal or the digestive tract facilitates the peristaltic waves that move swallowed food and nutrients.</u>
4 0
2 years ago
Read 2 more answers
Other questions:
  • What are two examples of heat or pressure that can form metamorphic rock
    14·2 answers
  • Energy enters most ecosystems as sunlight. Within an ecosystem, energy is transformed, used, and exits the ecosystem as heat. Dr
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A scientist is observing cells undergoing division and identifies a cell that contains 15 pairs of homologous chromosomes. Howev
    15·1 answer
  • Can earthquake sensors detect tsunamis​
    6·1 answer
  • The sun of all possible traits that new offspring of a species could inherit is known as the
    7·1 answer
  • All the carbon atoms that exist now are ____________? its on amplify science HELP NOW!!!
    15·1 answer
  • Do you think monogamy and polygamy are reproductive strategies? In terms of species survival, what are the advantages and disadv
    12·1 answer
  • Which plate does not appear in both hemispheres?
    5·2 answers
  • True or false: our thumb is as long as our nose
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!