1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Simora [160]
3 years ago
5

What would go wrong if cell division occurred without the s phase?

Biology
2 answers:
Tanya [424]3 years ago
7 0

If a cell has not properly copied its chromosomes or there is damage to the DNA, the CDK will not activate the S phase cyclin and the cell will not progress to the G2 phase. The cell will remain in S phase until the chromosomes are properly copied, or the cell will undergo programmed cell death.
borishaifa [10]3 years ago
5 0

Answer:

If a cell has not properly copied its chromosomes or there is damage to the DNA, the CDK will not activate the S phase cyclin and the cell will not progress to the G2 phase. The cell will remain in S phase until the chromosomes are properly copied, or the cell will undergo programmed cell death.

Explanation:

You might be interested in
Which two body systems function with alveoli to provide oxygen for the cells of the body? question 3 options: integumentary and
sertanlavr [38]

Answer

            Respiratory and circulatory system work close together with alveoli to provide oxygen to cell.

Explanation

                 Through the process of respiration when oxygen reaches to lungs and then to alveoli. Here oxygen is diffuse to blood through capillaries by the process of partial pressure diffusion. Oxygen combine with hemoglobin present in red blood cells. Now with the help of circulatory system this oxygen is transported to all other parts of the body where needed.

8 0
3 years ago
Read 2 more answers
Are all cells able to survive on their own?
vfiekz [6]

Answer: No

Explanation: Cells survive in different ways, A cell from your brain could not survive in a Petri dish for very long. It doesn't have the right pieces to live on its own.

6 0
3 years ago
Sarah and John are having a discussion on genetic diversity. Sarah believes that it happen over a long period of time. John it h
professor190 [17]
Sarah is correct because genetic diversity occurs over along period of time
4 0
4 years ago
What has numerous hair like projections from their flagella
kobusy [5.1K]
I think it's ameoba but I'm sorry if I'm wrong
4 0
3 years ago
Which property supports the hypothesis that eukaryotic mitochondria were once prokaryoticorganisms?
svet-max [94.6K]
- double membrane
- they have their own DNA
- size similar to prokaryotes 
6 0
4 years ago
Other questions:
  • Los combustibles fósiles son fácilmente disponibles y baratos?
    10·1 answer
  • What is it called when someone gets sick from eating food contaminated with germs or toxins?
    10·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What functional group is commonly used in cells to transfer energy from one organic molecule to another?
    10·1 answer
  • A group of similar cells that work together will form a(n)
    9·2 answers
  • ______ contains large amounts of potassium
    15·2 answers
  • What is the discriminat of the quadratic equation 3-4x=-6x^2
    6·1 answer
  • Earth is composed of which of the following spheres?
    15·1 answer
  • Please answer this question (WILL GIVE BRAINLEST) <br> ( i inserted a picture)
    12·1 answer
  • Platelets helps us in fighting against diseases. ______.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!