1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
3 years ago
13

Describe the discoveries that led to the modeling of DNA.

Biology
1 answer:
4vir4ik [10]3 years ago
8 0

Answer:

Chargaff discovered base pairing rules. Franklin took X-ray photographs that revealed that DNA has a spiral structure. This finding helped Watson and Crick create a model of DNA and discover the double-helix.

Explanation:

You might be interested in
How does the speed of flowing water affect its ability to erode <br><br><br> HELP PLZZZ!!!
sergeinik [125]

Answer:

<h3>Moving water also picks up and carries particles of soil and rock. The ability to erode is affected by the velocity, or speed, of the water. ... As water slows, larger particles are deposited. As the water slows even more, smaller particles are deposited.</h3>

Explanation:

6 0
2 years ago
Summarize the key factors DNA polymerase requires to replicate DNA.
vaieri [72.5K]

Answer:

Explanation:

DNA polymerase is an enzyme that helps in the synthesis of new strands of DNA. It is found in both prokaryote and eukaryotes. In prokaryotes, there are 3 types of DNA polymerase and more DNA polymerase found in eukaryotes.  

The 3 types of DNA polymerase are DNA polymerase I, DNA polymerase II, DNA polymerase III.  The DNA pol I and DNA pol II helps in DNA repair rather than DNA replication. The DNA pol III is the major enzyme that initiates the replication.  

DNA polymerase III is a multisubunit enzyme that functions as a dimer of these multiple subunits. The DNA polymerase enzyme has 3 significant enzymatic activities -  

All DNA polymerase direct the synthesis of DNA from 3' to 5' end.

It possesses 3' to 5' exonuclease activity. It also helps in proofreading activity by replacing the incorrect nucleotides with the correct base sequence.  

Some DNA polymerase has a 5' to 3' exonuclease activity. It is found in the lagging strand.

DNA polymerase is not able to initiate DNA synthesis alone. They need a free 3' end, where the enzyme can add new nucleotides. It means they require 2 primers to initiate the DNA replication in both the direction.  

The strands act as complementary to the DNA polymerase. The DNA polymerase adds new strands continuously in 5' to 3' direction in the leading strand. While in lagging strand short fragments of DNA formed. Later they attached by DNA ligase.

DNA polymerase also needs RNA polymerase in some cases to start replication. Such a process is called reverse transcription.

7 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
A polypeptide only becomes a functioning protein after it has folded into its exact 3D shape.
makkiz [27]
True. A protein becomes functional only when it reaches its tertiary shape (3D). It is not necessary for the protein to reach the quaternary stage, but that is just a more complex functioning protein. It really is just two tertiary merged together. Example is red blood cells.
4 0
2 years ago
A velocity-time graph shows how<br> I<br> changes over<br> time.
stich3 [128]

Answer:

What does a linear velocity graph tell us?

The principle is that the slope of the line on a velocity-time graph reveals useful information about the acceleration of the object. If the acceleration is zero, then the slope is zero (i.e., a horizontal line). If the acceleration is positive, then the slope is positive (i.e., an upward sloping line).

What is an acceleration time graph?

A graph that shows acceleration plotted against time for a particle moving in a straight line. ... The acceleration-time graph is the graph y=a(t), where the t-axis is horizontal and the y-axis is vertical with the positive direction upwards.

graph shows changes in velocity of a moving object over time. The slope of a velocity-time graph represents acceleration of the moving object.

Explanation:

Download docx
6 0
2 years ago
Other questions:
  • HELP ME PLZ
    15·1 answer
  • Scientists all agree we need sleep, but there is no consensus<br> on why true or false?
    9·1 answer
  • The annual hot dog eating contest at the fair gives a $100 prize to the contestant who eats 30 hot dogs in the least time. If al
    15·1 answer
  • Plant cells swell if water enters them through?​
    15·1 answer
  • By what reproductive mechanism does a haploid animal grow?
    15·2 answers
  • What are some health problems associated with high- protein diet if followed for extended time?
    7·1 answer
  • Glucose molecules contain stored energy for plants. Glucose is made from carbon dioxide and water molecules during photosynthesi
    11·1 answer
  • What are the charges both inside and outside of the neuron before you click the stimulate neuron button?
    6·1 answer
  • GIVING BRAINLEST!!
    5·1 answer
  • Grace wanted to find out the best conditions for growing lettuce plants.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!