1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
15

Compare the charges and masses of protons,neutrons. And electrons

Biology
1 answer:
Wittaler [7]3 years ago
3 0
Protons are positive and 1 atomic mass unit (or AMU), neutrons are neutral and 1 AMU, and electrons are negative and have no real weight.
You might be interested in
In sheep, white wool is dominant over spotted wool. If 10 purebred white wool sheep (TT) are crossed with 10 spotted wool sheep
Nitella [24]
4 offspring will have spotted wool, because there would be 10 offspring between 20 sheep, it is not half, because one side is dominate.
3 0
4 years ago
Identify the step in which water returns to Earth’s surface from the atmosphere
Nina [5.8K]
This is an example of the Water Cycle.
Water returning to the Earth from the atmosphere would be precipitation
6 0
3 years ago
Read 2 more answers
What life-threatening infection can result from allowing a urinary tract infection to go untreated in an older adult?
JulsSmile [24]

Hi!

Your answer is C

Which is also known as sepsis


~CoCo

3 0
4 years ago
The _____ works with the Environmental Protection Agency to enforce marine biology regulations along the coast and in the Great
likoan [24]

The <u>Coast Guard</u> works with the Environmental Protection Agency to enforce marine biology regulations along the coast and in the Great Lakes channels.

Answer: Option A

<u>Explanation:</u>

The Environmental Protection Agency (EPA) takes initiative to instill certain regulations to maintain the Ocean and its resources with the help of coastal guards and NGO’s. The Ocean coast is polluted due to various avoidable and unavoidable pollutants like oil leakage, industries letting in their waste, ship wrecks etc.

President Richard Nixon was the one who created this EPA. The EPA takes utmost care by educating the people of the necessity to maintain the coast in a disciplined attitude so as to have a pollution free oceanic coast which would in turn not adhere into the relevant working stream. Avoiding litter is the main rule that has been imposed.

5 0
3 years ago
Read 2 more answers
What is the difference between an experiment and scientific investigations?
jasenka [17]

Answer:

Investigation: a searching inquiry for gathering detailed facts...

Experiment: an orderly procedure carried out with the goal of verifying , refuting or establishing the valitity of a hypothesis.... .

Explanation:

Sadanvama1979 GREETINGS

8 0
3 years ago
Other questions:
  • 1. The Earth's carbon cycle consists of the flow, cycling, and recycling of all of the carbon on the Earth. Every living organis
    12·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • The reason that men who have enlargement of the prostate gland experience urinary symptoms is:_______.A. The prostate gland is p
    6·1 answer
  • During succession, what might become the limiting factor for sun loving mosses as taller plants begin to grow?
    8·1 answer
  • What horticultural method is used most often for vigorous rootstocks that do not produce good quality fruit or flowers?
    14·2 answers
  • HELP ME PLEASE 10 pts!!
    5·1 answer
  • Explain the phenomenon you observe in the diagram. Provide as many details as possible to your explanation
    9·1 answer
  • What exactly is an unbalanced force? How is that different from a balanced force and how things move? Give an example of an unba
    11·2 answers
  • How would you describe the traits of this population?
    8·2 answers
  • Place the following events in order from what happened first (oldest) to what happened most recently (youngest) on the geologic
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!