1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
4 years ago
7

Choose the answer.

Biology
1 answer:
Brilliant_brown [7]4 years ago
5 0

<u>Wernicke's area</u> was probably injured in his accident.

<u>Option: B</u>

<u>Explanation:</u>

The Wernicke area is the brain region which is required for the development of languages. It is situated in the temporal lobe on the left side of the brain and is essential for speech comprehension, whereas the region of Broca is connected to speech output.

The area is situated in the cerebral hemisphere's left portion generally near posterior region of the Superior Temporal Gyrus (STG).The brain's section named as lateral sulcus where the gathering of temporal lobe and parietal lobe take place in the auditory cortex, is covered in this zonal area.

You might be interested in
How are triglycerides formed?
Stolb23 [73]

Answer:

Each of the three fatty acid molecules undergoes an esterification with one of the hydroxyl groups of the glycerol molecule. The result is a large triester molecule referred to as a triglyceride. Figure 14.2. 4: A triglyceride molecule can be formed from any combination of fatty acids.

Explanation:I hope I can help you :)

8 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
What are the characteristics of bacteria
Hitman42 [59]

Answer:

like Eukaryota cells in that they have cytoplasm, ribosomes, and a plasma membrane.

Explanation:

eukaryotic cell include the circular DNA of the nucleoid, the lack of membrane-bound organelles,

6 0
3 years ago
Read 2 more answers
A large percentage of the sun’s energy is absorbed by earth’s surface. true false
Firdavs [7]
It's going to be true 
4 0
3 years ago
Read 2 more answers
I need help Plz!(this is due today)
Gelneren [198K]

Answer:

a

Explanation:

3 0
4 years ago
Read 2 more answers
Other questions:
  • Which endocrine gland is responsible for the release of the hormone that stimulates T-cell development and proper immune respons
    14·1 answer
  • You can prove siblings are related by
    9·2 answers
  • HELP!!!!!! FAST
    13·2 answers
  • What is one difference between a cell wall and a cell membrane?
    12·1 answer
  • What happens to the centrosome during interphase?
    12·1 answer
  • How does scientists use ice to study ancient climates
    13·1 answer
  • Which of the following is an example of a tissue?
    10·1 answer
  • What is the function of the excretory system?
    15·1 answer
  • What happens if one stage of a plant life cycle is skipped?
    7·2 answers
  • 2. ALL organisms ____ for resources to help them survive and reproduce
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!