1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marta [7]
3 years ago
13

Pleaseeee help mee :')

Biology
2 answers:
leonid [27]3 years ago
6 0

Answer:

sea floor spreading occurs at mid ocean ridges

goldenfox [79]3 years ago
3 0

Answer:

As given below

Explanation:

<em>1. mid-ocean ridges </em>

<em>2. as the plates slip past each other at these boundaries. </em>

<em>3. wide dome shape and thick lava. </em>

<em>4. An oceanic crust is subducted under the continental crust. </em>

<em>5. the continents were once together as the one supercontinent. </em>

  • Thus due to the seafloor spreading the formation of new plates is done from the mid-oceanic crust.
  • The transform fault is the margin that is moving back and forwards direction in dextral motion and hence this boundary is prone to earthquakes and volcanic eruptions and floods.
  • Cinder cone and stratovolcanoes have a high density of lava and have a wide shaped dome. A trench is formed due to the collapse of a plate of lighter mass with that f heavier mass which sinks below and this then brings into the mantel and subduction takes to form a deep trench.
You might be interested in
Explain how the work done by rosalind franklin and maurice wilkins helped inform watson and cricks model of the structure of dna
strojnjashka [21]
Rosalind Franklin and Maurice Wilkins conducted experiments using X-ray crystallography to study the structure of the DNA. Their experiments produced the famous photo 51, the first evidence on the structure of the DNA. Their work showed that DNA is double-stranded and forming a helix. They also showed that the nitrogenous bases are on the inside of the strands and that the phosphates are on the outside. Watson and Crick used these observations to develop their model on the molecular structure of the DNA. 
3 0
4 years ago
The only food source for plants is glucose. Describe how plants are able to produce all other necessary biomolecules. Use the wo
olasank [31]
Me toooooooo but girl go to thisisstudy
4 0
3 years ago
Read 2 more answers
How are meiosis and mitosis similar?
AleksAgata [21]

Answer:

b

Explanation:

they both produce new cells.

8 0
3 years ago
Read 2 more answers
What is the function of the Golgi apparatus?
Taya2010 [7]
It processes and bundles macromolecules like proteins as they are synthesized in the cell. It is also involved in secretion and intracellular transport.
6 0
4 years ago
Read 2 more answers
Which of the following is true of innate behaviors that are described as instincts?
yanalaym [24]

Answer:

innate behavior described as instinct are regarding food, shelter, bonding with others of same species, protection..and love.

Explanation:

sigmund Freud describes human primal instincts as being every humans basic needs 4 survival...

7 0
3 years ago
Other questions:
  • Joel is comparing two slides showing chromosomes in a sperm cell and a skin cell of a dog. He finds that the sperm cell has 39 c
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • If the ecosystem is a closed system, which of these things does not change as it cycles through the ecosystem?
    8·2 answers
  • Compared to absolute dating, what is an advantage of relative dating? A single fossil can be dated by itself. The actual age of
    15·1 answer
  • The region of cerebral cortex inferior to the lateral sulcus is the __________ lobe.
    9·2 answers
  • A minerral that has no particular planes of weaknees in its lattice structure, so it dose not break along patticular planes. Wha
    5·1 answer
  • Look at this pic and help me out please
    12·1 answer
  • The table shows the nature of reactants and products formed in a certain type of chemical reaction.
    5·1 answer
  • Do you think that governments should institute measures to control the human population? Please don’t send me those file things.
    9·1 answer
  • Pls help I’m way too dum: If water is continuously moving through the water cycle, why is it so important to conserve water?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!