1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WINSTONCH [101]
3 years ago
6

Mitochondria are organelles in which 1. Digestive enzymes are stored 2. Secretory products are packaged and stored 3. The energy

needed by the cell is released from nutrients 4. Chloroplasts and nutrients
Biology
2 answers:
melisa1 [442]3 years ago
8 0
I believe that it's 3. The energy needed by the cell is released from nutrients.
Mrac [35]3 years ago
7 0
A mitochondria is the powerhouse of the cell so i'm assuming CHLOROPLASTS AND NUTRIENTS 
You might be interested in
Examine the following genetic sequences and determine which pair are the most similar based on their ED (evolutionary distances)
kakasveta [241]

Answer:

Species 1 = ATTGGCCATT and Species 3 = TTTGGCCATT are the most similar.

Explanation:

Evolutionary distance (ED) is defined as the total number of substitutions of nucleotide in one site between two DNA sequences that are homologous. It is also referred to as the number of substitutions of amino acid in one site between two protein sequences that are homologous. Based on the definition of ED, the two most similar species are species 1 and 3.

8 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Most yellow jacket wasps are unable to survive the winter. Typically, only the queen and a few other wasps are able to survive t
crimeas [40]

Answer: density-independent factors

Explanation:

The ecological concept that best categorizes weather (i.e., temperature) as a limiting factor in yellow jacket wasp survival is referred to as density-independent factors.

Density-independent factor, is also referred to as limiting factor, and it simply means the things that have an impact on the population of the living things in a particular area without taking into consideration of the density of the population for the area e.g food limitation, weather conditions, pollutants, fire etc.

5 0
3 years ago
Catalase is an enzyme that decomposes hydrogen peroxide into water and oxygen. Hydrogen peroxide naturally forms in the body fro
omeli [17]

Answer:

okay

Explanation:

I was thinking it was a question

5 0
3 years ago
​Why is methane more dangerous than carbon dioxide with regard to anthropogenic climate change?help need help ASAP plz
Rudik [331]

Why is it as critical to address as carbon dioxide? In the first two decades after its release, methane is 84 times more potent than carbon dioxide. ... While methane doesn't linger as long in the atmosphere as carbon dioxide, it is initially far more devastating to the climate because of how effectively it absorbs heat.

3 0
3 years ago
Other questions:
  • What is the significance of secondary growth in plants?
    13·2 answers
  • What memorable line does taylor first utter in the presence of the apes?
    14·1 answer
  • What type of membrane protein has a
    13·1 answer
  • The last two pairs of ribs that have no cartilaginous attachments to the sternum are sometimes called _________ ribs.
    10·2 answers
  • Explain the following statement "digestion begins in the mouth"
    15·1 answer
  • How do sponges get rid of waste products with no digestive tracts?
    9·1 answer
  • How many homologous pairs of chromosomes are present in a somatic cell?
    9·1 answer
  • How do symptoms created by inflammation help the doctor
    6·1 answer
  • From prophase through metaphase of mitosis, each chromosome has _____ DNA molecule(s), while from anaphase through telophase of
    11·1 answer
  • As invasive species, how does the introduction of the feral pig and the water hyacinth impact an ecosystem? (Site 1)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!