1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zloy xaker [14]
3 years ago
7

Arithmetic sequence...3,5,7,11....the next two terms​

Biology
1 answer:
Julli [10]3 years ago
5 0

Answer:

13,15

Explanation:

the sequence is adding by (+2)

You might be interested in
Which of the following has the fewest taste receptors?
kolbaska11 [484]

Answer:

filiform papillae

Explanation:

The filiform papillae, also called conical papillae, are sensory receptors distributed on two thirds of the lingual dorsum. They are the most abundant papillae on the surface of the tongue and are not associated with taste reception because they have the smallest number of taste receptors.

These papillae are arranged fairly evenly in rows parallel to the central groove of the tongue, especially in the center and back. These papillae are made up of connective tissue and an epithelium that expresses keratin, a protein present in people's skin, hair and nails.

5 0
3 years ago
A pattern of reproduction and growth in a one- celled organism is shown below. Nucleus Which statement best describes this patte
iogann1982 [59]
It is a. all genetic material comes from one parent
4 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
The largest or most important part of an organ is termed the
masha68 [24]
Hello, this would be known as the sim/o.
Hope this helps<3
4 0
3 years ago
What is a stem cell research?
Ludmilka [50]
Stem cells<span> are a class of undifferentiated </span>cells<span> that are able to differentiate into specialized </span>cell<span> types. Commonly, </span>stem cells<span> come from two main sources: Embryos formed during the blastocyst phase of embryological development (embryonic </span>stem cells<span>) and. Adult tissue (adult </span>stem cells<span>).

hope this helps!</span>
6 0
3 years ago
Other questions:
  • Crater Lake in southern Oregon is not a crater but actually a ___.
    5·2 answers
  • Which organelle packages the material used to build the cell plate in plant cells
    8·1 answer
  • Demonstrate through chemical modeling what happens to the protein structure (keratin) of curly hair after a chemical relaxer and
    10·1 answer
  • Which of the following is not a reason that introduced species are a threat to biodiversity? (1 point)
    9·1 answer
  • The planets closest to the Sun are the inner, or terrestrial, planets and are similar to Earth in some ways. They are rocky and
    5·2 answers
  • An animal cell lacking oligosaccharides on the external surface of its plasma membrane would likely be impaired in which functio
    11·1 answer
  • Please HELP!!!
    13·1 answer
  • A building project caused many small mammals and insects to leave an area. What effect could this have on plant reproduction in
    13·2 answers
  • An egg, a model of a cell, is placed in a concentrated sugar solution (hypertonic) for 24 hours.
    12·2 answers
  • A mother with heterozygous type A blood wants to have a baby with type B blood. What blood type for the father would give the ba
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!