Constructive plate boundaries
The correct answer is 4) A dichotomous key is complete when each organism stands alone.
The statement about a dichotomous key that is true is "A dichotomous key is complete when each organism stands alone."
Scientists have the need to correctly identify organisms, animals, plants, and objects. For that to happen, they have dichotomous keys.
These tools help them to identify and give a correct name that differentiates from other objects and organisms. So the most important thing about the dichotomous key is the fact that it identifies an organism, species or objects with its scientific name.
-lung cancer
-breast cancer
-prostate cancer
-brain cancer
And many more...
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Im guessing C because it appears it doesn’t have the smallest range
