DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. ... Most DNA is located in the cell nucleus
These groups are arranged in order from most inclusive (most general) to least inclusive (most specific) is gnathostomes, osteichthyans, lobe-fins, tetrapods, amphibians.
<h3>What is
gnathostomes?</h3>
The jawed vertebrates are called gnathostomata. The phrase comes from the Greek words "jaw" and "mouth." Approximately 60,000 species make up the diversity of the gnathostome, which represents 99% of all vertebrates still alive today.
<h3>What is
osteichthyans?</h3>
A broad taxonomic group of fish called osteichthyes, also known as the "bony fish," has skeletons that are predominantly made of bone tissue.
<h3>What is
lobe-fins?</h3>
The taxon Sarcopterygii, also known as Crossopterygii, is made up of bony fishes noted for having lobe-finned fishes as its members.
<h3>What is
tetrapods?</h3>
Four-legged vertebrates that make up the superclass Tetrapoda are known as tetrapods, which derives from the Ancient Greek (tetra-) "four" and "foot." It consists of synapsids, dinosaurs, and extinct as well as living amphibians, reptiles, and dinosaur-related birds (including mammals).
To learn more about Tetrapods visit:
brainly.com/question/15289594
#SPJ4
1. Carrots, rabbit, snake, eagle
2. Sun, berries, bear
3. Grass, snail, bird, fox
Diabetes insipidus is a disease characterized by excessive thirst and the excretion of large amounts of highly diluted urine, which can not be reduced by a reduction in fluid intake.
Diabetes insipidus is due to a deficiency of antidiuretic hormone or insensitivity of the kidneys to this hormone. This hormone causes water reabsorption via action on the distal segment of the nephron during dehydration.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.