1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hram777 [196]
3 years ago
6

Forensic scientists can match missing persons and their families by matching maternal DNA to the missing individual. Which type

of DNA technology is used for this purpose?
Biology
2 answers:
andrey2020 [161]3 years ago
4 0
<span>mtDNA analysis is the best DNA technology to use. In DNA fingerprinting scientists run a gel electrophoresis of the subject's DNA in order to establish the banding patterns of the DNA fragments. People will always share half of their DNA with a parent. SO half of an individual's banding pattern will match half of their parent's DNA banding pattern. If someone is missing is found then scientists can compare the DNA fingerprint or banding patterns to see what the likelihood is of them being related.</span>
hjlf3 years ago
3 0

Answer:

mtDNA analysis

Explanation:

You might be interested in
When is the best time to wear a stripped sweater?
Nesterboy [21]

Answer:

all the time is the correct answer

6 0
3 years ago
Why do communities and populations differ?
Setler79 [48]
A population is the population in a community

A community contains a population

Have a Brainly Day!

8 0
3 years ago
Serotonin and Dopamine are 2 of the many neurotransmitters that are released when a synapse occurs.
Murrr4er [49]

Answer:

it is true

Explanation:

6 0
2 years ago
The cubic centimeter (cm3) is a measurement of which of the following quantities?
Sati [7]
The cubic centimeter (cm30 is a measurement of Volume.
6 0
3 years ago
Read 2 more answers
Which of the following is a function of body fat? a. It is an important component of teeth. b. It is a source of some hormones.
labwork [276]

Answer:

c

Explanation:

3 0
3 years ago
Other questions:
  • Which organ systems are used to help the body shiver?
    14·2 answers
  • The human chromosomes together contain 30% adenine. apply chargaff's rules to calculate the percentages of thymine, guanine, and
    7·1 answer
  • What do volcanoes have to do with the carbon cycle ?
    10·1 answer
  • Red blood cells contain approximately a 2% concentration of solutes. a red blood cell is placed into a solution that contains a
    14·1 answer
  • Hooked up to an eeg and his brain is producing fast and irregular waves. tyson is most likely:
    13·1 answer
  • What two pieces of information are needed to determine ocean depth through echo-sounding?
    14·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Dan gave five sunflower seedlings each a different type of fertilizer. He measured the initial and final heights of each plant a
    9·1 answer
  • Sam drives an excavator at an open surface strip coal mine. Which type of coal is he most likely to collect closest to the surfa
    9·1 answer
  • Why are detritivores important to an ecosystem
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!