1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ludmilka [50]
3 years ago
13

In each of the scenarios, an individual heterozygous for the indicated gene or genes is crossed with an identical heterozygous i

ndividual. Predict the number of different phenotypes that would be observed among the progeny of such a cross.
Scenario 1: R is completely dominant to r.
Scenario 2: R is incompletely dominant to r.
Scenario 3: R and s are completely dominant to rand s, respectively: R and S are linked by 10 m.u. and don't interact with each other.
Scenario 4: Genes R and S perform the same finction: R and S are completely dominant to r and s, respectivley' and R and S are unliked.
Scenario 5: R and S are completely dominant to r and s, respectively; R and S are unlinked show dominant epistasis.
Biology
1 answer:
Leno4ka [110]3 years ago
3 0
Oi como você está? Decênio 1:
You might be interested in
Near witch major city were iron works found
Hoochie [10]
Atlanta, Georgia, and Fulton county
6 0
3 years ago
This element is found in all living things. It is recycled when organisms die. It is transformed from one form to another throug
nevsk [136]
Either, carbon, hydrogen, nitrogen, oxygen, phosphorus, or sulfur. I would go with carbon because of the photosynthesis and cellular respiration<span />
8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
What macromolecule is the most common in the item in the picture?
Rama09 [41]

Answer:

If that is a picture of DNA, then nucleic acids are the most common macromolecule

Explanation:

5 0
2 years ago
Find out what do the terms algal bloom and red tides signify​
ch4aika [34]

Answer:

Find out what do the terms 'algal bloom' and 'red-tides' signify. Algal bloom refers to an increase in the population of algae or blue-green algae in water due to an enrichment of nutrients, resulting in discoloration of the water body. ... Red tides are caused by red dinoflagellates (Gonyaulax) that multiply rapidly.

I hope it's helpful!

4 0
2 years ago
Read 2 more answers
Other questions:
  • In the diagram, the undarkened circles represent
    7·2 answers
  • What is the study of like called
    5·2 answers
  • From which sphere of earth did this food originate
    5·1 answer
  • Why does a egg change color and texture when heated
    15·1 answer
  • The bulk of the atp for aerobic exercise comes from the oxygen-requiring process of _____.
    5·1 answer
  • Which of the following explains why antibiotics can treat flu-like symptoms caused by bacteria but are ineffective against flu?
    10·1 answer
  • Explain how the daily energy needs are different between the zebra and its predator, the lion. Be certain to include any importa
    6·1 answer
  • Fluid in the inner ear creates a sense of
    13·1 answer
  • The reactions of glycolysis that are shared with those in gluconeogenesis (ie use the same enzymes) are those that: Are substrat
    5·1 answer
  • why is it not advisable for farmers to use large amounts of artificial fertilizer especially in close proximity to a pond or lak
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!