Answer:
I can't see the pictures are you sure you uploaded them please lmk
D all of the above would be the correct answer
Lysozymes are under the enzymes-functional class of proteins. Enzymes are the ones responsible for the acceleration of chemical reactions. These are the macromolecular biological catalysts. <span> When we say enzymes, these are proteins which are directly related to the facilitation of the biochemical reactions. These include lactase and pepsin. You can usually hear these when learning about specialty diets or digestive medical conditions. Some of the examples of this protein’s presence are found in tears, human milk, saliva, and mucus. It is because of their ability to break down bacterial cell walls in order to protein improvement and nucleic extraction of efficiency make these lysozymes important </span>proteins<span> in living organisms. The gene responsible for the encoding of the lyzozome enzyme is called the LYZ gene.</span>
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
They are called
a. sunspots