1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vfiekz [6]
3 years ago
7

Which of the following factors does not affect membrane permeability?A) The polarity of membrane phospholipids.B) Temperature.C)

The amount of cholesterol in the membrane.D) The saturation of hydrocarbon tails in membrane phospholipids.
Biology
1 answer:
lapo4ka [179]3 years ago
3 0

The correct answer is: A) The polarity of membrane phospholipids

Factors that affect membrane permeability are

1. Chemicals :

Some of the organic solvents such as chloroform and ethanol can dissolve the membrane and thus, destroy the selective permeability of the membrane.

2. Temperature :

Too high temperatures denature the protein that are in the structure of the membrane destroying its selective permeability. On the other hand, too low temperature slows down molecule movements and the permeability decreases.

3. Cholesterol:

Increases the permeability by reducing the barrier formed by phospholipids’ heads

4. The saturation of hydrocarbon tails in membrane phospholipids:

Saturated fatty acids decrease permeability of the membrane because  they get very close together, which makes it harder for the molecules to pass through.

You might be interested in
Tan mice lived in regions with sandy hills. Over time, many of these tan mice migrated to a region with dark-colored hills. Even
AleksandrR [38]
The first, second, and fourth statements are correct.
3 0
3 years ago
Which of the following occurs during mitosis but
marissa [1.9K]

Answer:

B) The chromatids of each chromosome are separated.

3 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Why do many reflexes, such as pulling your hand away from a hot iron, happen so quickly?
sertanlavr [38]
Your nervous system quickly responds to the threat and sends a signal to your brain which causes your muscles/ body to react.
HOPE THIS HELPS!
3 0
3 years ago
Read 2 more answers
Who else thinks it is very stupid that parents can think they can make Your girlfriend be with someone in their best friends fam
Montano1993 [528]

Answer:

i think it is idiotic.

Explanation:

its your choice who you like. to make the rents happy, just fake it that you like her.

5 0
2 years ago
Other questions:
  • In an expirment on traffic, 20 cars are observed driving down a street in 4 hours.What rate of traffic was observed in this expe
    9·2 answers
  • Where does the sun set east or west
    13·1 answer
  • Which type of mechanical weathering is most common in mountainous regions in the middle latitudes?
    10·2 answers
  • Mr. carusa has chronic hypertension. he is scheduled for a procedure in which x-rays are taken after contrast material is inject
    5·1 answer
  • Help me please,Thanks
    8·1 answer
  • What are ways that water vapor can reenter the atmosphere
    10·2 answers
  • Which sentence best describes the function of nucleic acids?
    12·1 answer
  • Why consumers would want GMO?
    15·1 answer
  • Does anyone have any idea what the answer could be for these?
    6·1 answer
  • If you run at 12 m/s for 15 s, how far will you go?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!