1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
3 years ago
6

Explain Ionic and covalent bonding

Biology
2 answers:
Lesechka [4]3 years ago
6 0
Covalent bond is when two atoms share one or more pairs of electrons, an example of this could be H20 or C02.

ionic bonds are when one or more electrons from am atom are removed and attached to another, which can result in positive or negative ions which attract each other, an example of this could be table salt.
Taya2010 [7]3 years ago
4 0

Ionic bonding:

An ionic bonding occurs when cations (positively charged) and anions (negatively charged) attract each other. In ionic bonding, atoms either loose electrons to become positively charged, in the case of metals, or gain electrons to become negatively charged, in the case of nonmetals. Molecules formed by ionic bonds are called salts.


Covalent bonding:

A covalent boding is the sharing of a pair of valence electrons between two atoms. When only one valence electron (electron in the valence shell (outermost shell)) is shared, the we call that a covalent bond. When two valence electrons are shared we call that a double covalent bond, such as the one found in an oxygen molecule.




Hope it helped,



BioTeacher101

You might be interested in
The chemical reaction in which glucose is converted to ATP in the mitochondria ​
pickupchik [31]

Answer:

Glycolysis

Explanation:

Glycolysis. Six-carbon glucose is converted into two pyruvates (three carbons each). ATP and NADH are made. These reactions take place in the cytosol.

7 0
3 years ago
Which disease is associated with excessive dopamine secretion, decreased gray matter in the temporal lobes, and abnormal hippoca
sergiy2304 [10]
Schizophrenia is the answer
8 0
3 years ago
Cilia:
Alexxx [7]

Answer:

E. All the answer options are correct.

Explanation:

Cilia are very small hair-like, membrane-bound cell structures. They are present on the surface of many eukaryotic cells. They are made of microtubules and are continuous with the plasma membrane of a cell. On a single cell, they are present in large numbers as compared to flagella. The major function of cilia is to move the cell or to move substances such as mucous, fluid over or around the cell.

3 0
3 years ago
Tipo de materia constituida por átomos de la misma clase
storchak [24]

Answer:

Un elemento químico es un tipo de materia constituida por átomos de la misma clase.​ En su forma más simple, posee un número determinado de protones en su núcleo haciéndolo pertenecer a una categoría única clasificada por su número atómico, aun cuando este pueda desplegar distintas masas atómicas.

Explanation:

3 0
2 years ago
Sara and Juan conducted an experiment to test which soil would be BEST for growing plants.
pantera1 [17]

Answer:

A. Type of soil

Explanation:

A control experiment is the one that is used to checkmate the real experiment.

In this case, the fourth jar that contains the mixture of all the types of the soil is considered as the control experiment.

In a nutshell, it should be generally understood here that the type of soil serves as the control for the experiment.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What do these characteristics all have in common? O They are all dominant. O They can all be easily observed. O They are all rec
    15·1 answer
  • Why is gene regulation necessary in the development of multicellular organism? Use a specific example to support your argument
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is one way that cancer can form?
    11·2 answers
  • The pollen in a flower is produced on which structure?
    6·2 answers
  • An atom has at least one positive proton and at least one negative electron. Which of the following is true about the protons an
    8·2 answers
  • Which of the following is an example of a nonmetallic mineral?
    12·2 answers
  • Hi PLS HELPP: 15 points
    12·2 answers
  • Which part of a molecule provides energy for life processes? *
    9·2 answers
  • The large intestine connects with the small intestine at the.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!