1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
In-s [12.5K]
3 years ago
11

What is chlorophyll, and what is it responsible for

Biology
1 answer:
GarryVolchara [31]3 years ago
7 0

There is a small, but very important molecule responsible for this called chlorophyll. All plants have chlorophyll, which is a green pigment in leaves and stems. Chlorophyll is a light-absorbing pigment, and it actually gets its green color because it absorbs blue and red wavelengths of light.

You might be interested in
Human blood cells have a salt concentration of about 0.9%. A patient's blood cell
soldier1979 [14.2K]

Answer: Saline

Explanation:

8 0
4 years ago
10. If there are very few differences in the DNA of two different species, what can we infer about their relationship? For examp
Burka [1]

Answer:

Chimpanzees.

Explanation:

DNA sequence similarity is helpful to determine the evolutionary relationship between the organisms. The evolutionary tree can easily be constructed if the percentage of the DNA sequence similarity is known.

The human shows 98.8% sequence similarity with chimpanzee. The sequence similarity between human and gorilla DNA is 98.4%. This means Chimpanzee are more closely related to humans than gorillas.

Thus, the answer is chimpanzee.

4 0
3 years ago
Which are limiting nutrients for plant growing
poizon [28]

Answer:

I believe it is : water and nitrogen

Explanation:

6 0
3 years ago
Which organisms carry out respiration,growth,movement and excretion
Nezavi [6.7K]

Answer:

Animals only is the correct answer

Explanation:

Hope this helps you

Crown me as brainliest:)

4 0
3 years ago
Explain how the process of diffusion works in a cell membrane
Deffense [45]
I think it is be division
3 0
3 years ago
Read 2 more answers
Other questions:
  • Amino acids are carried to ribosomes by what?
    15·1 answer
  • Which of the following may cause a 12-year-old to have a height above 6 feet?
    7·1 answer
  • If a woman complains of back labor pain, what is the best suggestion by the nurse
    11·1 answer
  • Suppose a disease caused the cuticle on a plants leaves to disappear. What would happen? Why?
    8·1 answer
  • Can you have a hypothesis that does not explain an observation?
    10·1 answer
  • Which is a predator/perey relationship?
    10·2 answers
  • Stem cells are important because _____.
    8·2 answers
  • Jayden is taking a test. He has to write why scientists support the theory that life began near hydrothermal vents in the ocean.
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is something your body does that keeps it from extreme changes?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!