1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
2 years ago
5

What is 17210000000 written in scientific notation? Enter your answer I’m the box

Mathematics
2 answers:
Law Incorporation [45]2 years ago
6 0

<u>Answer: </u>

1.721 \times 10^{10} is scientific notation of given number 17210000000.

<u>Solution: </u>

Given number which needs to be converted into scientific notation is 17210000000.

Scientific notation is standard way of representing very large number or very small number.

In scientific notation, decimal comes after first digit and multiply to power of 10 dependency on total digits of number.

In our case, given number is 17210000000.

So we need decimal after first and after that number of digits are 10.

So 17210000000 = 1.721 \times 10^{10}

Hence 1.721 \times 10^{10} is scientific notation of given number 17210000000.

pochemuha2 years ago
3 0

Answer: 1.721 to the power of 10

Step-by-step explanation:

You might be interested in
In Lixue’s garden, the green pepper plants grew 5 inches in 34 month. At this rate, how many feet can they grow in one month? (L
beks73 [17]

Answer:

<h2>0.15 inches per month</h2>

Step-by-step explanation:

step one:

This problem is focused on the growth rate of a plant.

given data

the plants grow 5 inches in 34 months

and also that 1 month= 4 weeks

step two:

We can still say that

if 34 months see a growth of 5 inches

then 1 months will be X inches

cross multiply we have

X= 5/32 inches

step three:

converting this number to decimal we have

X= 0.15 inches per month

Therefore the growth rate would be

0.15 inches per month

5 0
3 years ago
Is rolling a 3 standard doe and then rolling a sum greater than 4 when counting the next roll an independent event?
zhannawk [14.2K]

Answer:

False

Step-by-step explanation:

In this question, you roll 3 from the standard die and then add it with the next roll to see if the sums are greater than 4.

From this explanation you can see that you use the result from your first roll for the second event, so we can conclude that the event is dependent.  

Imagine if we change the result of the first roll into 5, without adding the second roll we can know that the sum will be greater than 4. The first event result will influence the second event, so it is a dependent event.

5 0
2 years ago
Help: The equation is in the screenshot
Svetllana [295]

The graph of the function shows that function f(x) => ∞ as x = -∞ and f(x) =>-∞ as x = ∞. Option c is correct.


<h3>What is a graph?</h3>

The graph is a demonstration of curves that gives the relationship between the x and y-axis.


Here,
The curve of the function in the 2 quadrants is increasing when x tends to -∞ and in the quadrant, the curve f(x) is decreasing to -∞ as x tends to ∞.


Thus, the graph of the function shows that function f(x) => ∞ as x = -∞ and f(x) =>-∞ as x = ∞. Option c is correct.

Learn more about graphs here:

brainly.com/question/16608196

#SPJ1


8 0
1 year ago
6, 12, 8, 14, 10, 16<br>What pattern do you notice here
spin [16.1K]
6,12,8,10,16


6+6=12-4=8+6=14-4=10+6=6
The pattern I noticed is it adds 6 and then it minus 4.
3 0
3 years ago
Read 2 more answers
I do not understand at all and my answer is probably completely wrong please help
tatuchka [14]
25 minutes!! you were very close, you just needed to translate the fraction to minutes!
4 0
3 years ago
Read 2 more answers
Other questions:
  • Someone help please? thanks.
    13·1 answer
  • Madison wants to order t-shirts for the university which consists of about 12000 students. she takes a random sample to figure o
    11·1 answer
  • what is the slope of the line that passes through the points (-7, -4) and (-11, -2) write your answer in simplest form
    15·1 answer
  • Factor this polynomial into the product of two binomials (30 points):
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Plz help me only 11 minutes left
    9·2 answers
  • Acil çözümünü yazın bana ​
    11·1 answer
  • Jake travels 6 hours for a total of 444 miles on 20 gallons of gas, rate for gallons and hours.
    11·1 answer
  • -7+ 3x-2(3x+4)= 5(2x-3) + 4 (3x - 1) - 4.
    15·1 answer
  • Please tell me how this done with steps so I can do this on my own as well
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!