1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pepsi [2]
3 years ago
10

Due to a car accident, a young woman suffered an injury to her spinal cord at first lumbar vertebra. What major function could b

e lost due to her injury?
A) walking
B) chewing
C) breathing
D) pushing
Biology
2 answers:
goldfiish [28.3K]3 years ago
5 0
"Walking would be the major function among the choices given in the question that <span>could be lost due to her injury. The correct option among all the options that are given in the question is the first option or option "A". I hope that this is the answer that has actually come to your great help.</span>
alexandr402 [8]3 years ago
4 0

Answer:

The correct answer will be option A-walking.

Explanation:

The spinal cord is a part of the central nervous system which carries the spinal nerves.  We depend on the spinal cord as it supports the main body posture of the body like standing upright, bending and twisting.

If this spinal cord is injured the person may suffer from various severe health implications like it will affect the walking ability as the spinal cord transmits the walking signals via neurons to the muscles in the legs which make them contract and relax. This contraction and relaxation produce the alternating movement of walking.

Thus, option A-walking is the correct answer.

You might be interested in
The weight of an object is related to its
sattari [20]
Pull Of Gravity , that is why you have weight or else without gravitational pull you only have mass hence the equation w = mg
6 0
3 years ago
Which question can most help a writer revise an argumentative essay?
miss Akunina [59]

Answer:

Do details provide support for the claim?

Explanation:

Your claim is the biggest part of your essay, it sets the tone for what is to be written and the details need to support the claim to back it up, to show the background of the claim. These details need to be precise to the claim because if not, the essay will not nor ever be near considered a good essay and that goes for all essays that have a thesis or claim in general.    

7 0
3 years ago
Which is NOT a function of sweat?
Helga [31]
Keeping you warm is not a function of sweat.it is soppose to keep you cool when you start to heat up.
5 0
3 years ago
Read 2 more answers
Which parts of the kidney responds to antidiuretic hormone?
attashe74 [19]
Proximal convoluted tubules
6 0
3 years ago
How do living things make use of the energy stored in food molecules?
ipn [44]
Answer:
             The energy stored in food molecule (glucose) is released in he process of respiration. 

Explanation:                     Respiration is a cellular process in which glucose molecule is broken down into carbon dioxide, water and ATP is produced as end product. Respiration consists of following main steps:
1. Glycolysis:                It occurs in the cytoplasm of cell, and each glucose molecule is converted into two pyruvates with help of ATP.
2. Formation of Acetyl coenzyme A:                                                        It is a connecting link reaction between glycolysis and Kreb cycle. In this phase Each pyruvate react with Coenzyme A to become acetyl coenzyme A.
3. Kreb Cycle:                   It occurs inside mitochondria. In this cycle each acetyl coenzyme A with fixed with CO to produce citrate which undergo in a cyclic reaction to produce ATP and NADH. . 
4. Electron transport chain:                                           It is the last step of respiration which complete in mitochondrial membrane. In this phase most of the energy is produced along with H₂O as by product.

4 0
3 years ago
Other questions:
  • What would happen to the moose population if the wolves were removed?
    9·2 answers
  • What do we call the study of the body structures we can see with our eyes?
    15·1 answer
  • Aidan has had non stop diarrhea all day and is severely weakened. why is his nurse concerned?
    12·1 answer
  • In a particular breed of cattle, the trait of not having horns (Pp) is dominant over having horns (pp). The Punnett square below
    5·1 answer
  • Which observation directly illustrates the adhesive properties of water ?
    6·1 answer
  • What is Holmes reaction to Dr.Roylott?
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why is oxygen more likely to form a polar covalent bond than other elements?
    14·1 answer
  • Explain why most nerve cells have a myelin sheath (2 marks)​
    14·1 answer
  • Hurry please!!!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!