1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delvig [45]
3 years ago
12

From which type of cells did ulticellular organisms arise?

Biology
1 answer:
slava [35]3 years ago
3 0
Multicellular organisms arose from E<span>ukaryotes, a single celled organism.</span>
You might be interested in
What is non living or not produced by living things
wariber [46]

Answer:

LIVING THINGS NON LIVING THINGS

They possess life. They do not possess life.

Living things are capable of giving birth to their young one. Non living things do not reproduce.

For survival, living things are depended on water, air, and food. They are self-dependent.

Living things are sensitive and responsive to stimuli Non living things are not sensitive and do not respond to stimuli

Metabolic reactions occur constantly in all living things. There are no Metabolic reactions in Non living things.

Living organisms undergo growth and development. Non living things do not grow or develop.

They have a lifespan and are not immortal. They have no lifespan and are immortal.

Living things move from one place to another. Non living things cannot move by themselves.

They respire and exchange of gases takes place in their cells. Non living things do not respire.

Example: Humans, animals, plants, insects. Example: Rock, pen, buildings, gadgets.

Explanation:

6 0
2 years ago
What is the difference between point source and nonpoint source water pollution
Komok [63]
Point source means: the pollution that comes from a single point (examples)

Sewage pipes releasing sewage into a ditch

Smokestack style factory chimneys

Oil pipes


Pollution which is caused by rain fall or snow melting into the ground. As the runoff moves, it picks up and carries away natural and human made pollutants, Finally reaching a lake, river, ocean, groundwater.







4 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Long ago, the tree of life was seen as having five branches.<br> True or False?
4vir4ik [10]

Answer:

false, hopefully iss right

3 0
2 years ago
Which type of rock is formed directly from heat<br>sandstone<br>igneous<br>sedimentary<br>Olivine
zloy xaker [14]

The answer is sedimentary rock

5 0
2 years ago
Read 2 more answers
Other questions:
  • Rabia is using a relaxation technique in which she systematically contracts and releases different muscle groups. What is the te
    7·1 answer
  • Which of the following has been a benefit of the space exploration efforts conducted from Florida? More jobs More revenue for th
    12·2 answers
  • The body converts all forms of simple sugars into which of the following substances to provide energy to cells?
    5·2 answers
  • Whats the answer to this A-T-G-C-C-A-C-A-G-G-G-A-T-G-A? template strand mrna amino acids​
    11·1 answer
  • PLS ANSWER QUICK. ILL GIVE YOU BRAINLIEST!!!
    15·2 answers
  • A population crisis usually occurs in a country that has:
    7·1 answer
  • Which statement is true of the climate of a desert
    12·2 answers
  • All veins return blood back to the heart except A-superior vena cava B-inferior vena cava C-Hepstic portal vein D-hepatic vein
    5·1 answer
  • List six alternative energy sources.
    14·1 answer
  • All organisms have the same amount of chromosomes.<br><br> A. True<br><br> B. False
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!