1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
8

Which compound would most likely be found in all living organism

Biology
1 answer:
nikdorinn [45]3 years ago
5 0

Answer:

oxygen

Explanation:

Living organisms often contain amounts of several elements, but the most abundant ones are oxygen, carbon, hydrogen, nitrogen, calcium and phosphorus. But Oxygen is the most abundant element contained within living organisms, composing about 65% of the human body.

You might be interested in
Fill in the blanks please I’ll mark you brainliest!
Zolol [24]

Answer:

16. a, research

Explanation:

you should form your hypothesis on research because based on what you researched is what will help you try predict the outcome of the experiment

6 0
2 years ago
The resting cell normally has a net negative charge with respect to the outside of the cell. what is this state called?
Zolol [24]
The answer is <span>polarized </span><span>state.</span>
5 0
3 years ago
Plz help me with these questions
bearhunter [10]

Answer:

heat energy

Explanation:

7 0
2 years ago
Read 2 more answers
Dust in the atmosphere represents:
Ronch [10]
Dust in the atmosphere represents suspension. It is collaborating shaped during colliding and collapsing of the interstellar mediums this is influenced by the gravitational attraction of the atoms and particles in the entitles. Hence, there are three types of nebular namely, are classical nebula, diffuse nebula, planetary nebular and supernova remnants.
4 0
3 years ago
Read 2 more answers
Place the events in the correct order:
Alecsey [184]

Answer:

1. Chromatin condense into chromosomes.

4. Homologous chromosomes pair up (formation of tetrads).

5. Homologous chromosomes separate and move to poles.

2. Sister chromatids separate.

3. Chromosomes unravel in to chromatin.

Explanation:

This question portrays the process of meiosis in a cell. The ordered sequence of events in the options are:

1. Chromatin condense into chromosomes - This process occurs in the Prophase stage. Prior to the cell division, the nuclear material is found as Chromatin material. This Chromatin material then undergoes condensation to form visible chromosomes.

4. Homologous chromosomes pair up (formation of tetrads) - This process also occurs during the Prophase stage of meiosis I. In this stage, homologous chromosomes (similar but non-identical chromosomes received from each parent) are paired up side by side to form a structure known as TETRAD or BIVALENT.

5. Homologous chromosomes separate and move to poles - This process characterizes the Anaphase stage of meiosis I. Homologous chromosomes are pulled apart to opposite poles of the cell by spindle microtubules.

2. Sister chromatids separate - After meiosis I, meiosis II involving sister chromatids instead of homologous chromosomes follows. In the Anaphase stage of meiosis II specifically, sister chromatids are pulled apart towards opposite poles of the cell.

3. Chromosomes unravel in to chromatin - After the whole division process i.e. karyokinesis (division of the nuclear material), the chromosomes begin to unravel to form the CHROMATIN threads once again. This process occurs in the Telophase stage of meiosis.

5 0
3 years ago
Other questions:
  • For a DNA strand that contains the sequence AGT in the 5’ to 3’ direction, what nucleotides are found on the other DNA strand in
    10·1 answer
  • Chinchillas
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • List the factors of 4
    10·1 answer
  • Jayden has been asked to wear a protective vest while his dentist takes an X-ray. Why is this?
    12·2 answers
  • Food Chain I Food Web LabNames:______________________Background Information:Plants use light energy from the sun to make food. T
    9·1 answer
  • Plants are called producers because they make their own food. Just like us, plants use their food for energy to respond, grow,
    11·1 answer
  • PLEASE HELP ASAP ILL GIVE YOU BRAINLIEST AND MOST HELPFUL!! ​
    12·1 answer
  • What is the name of substance that the cells do not recognize in the body?
    11·1 answer
  • I need someone to do a essay for me the information about the essay is in the picture
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!