1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pashok25 [27]
2 years ago
6

Ground pork should be cooked to an internal temperature of _______________ to destroy the parasite Trichinella spiralis.

Biology
1 answer:
patriot [66]2 years ago
3 0

Answer:

160°

Explanation:

Ground pork should be cooked to an internal temperature of 160° to destroy the parasite Trichinella spiralis. 160°F (71°C) 89. All of the following are good instructions for preventing foodborne illness except when shopping, select meat, poultry, or fish first.

You might be interested in
NEED ASAP !!!!!
Anni [7]
The answer is, <span>A.low pressure, high winds, high precipitation</span>
4 0
3 years ago
Read 2 more answers
A forest fire destroys an area. Asmall population of trees and a large population of birds are both affected.
Afina-wow [57]
A. density dependent.
4 0
3 years ago
The skeletal structure of the front limbs of 6 animal: human, crocodile, whale, cat, bird, and bat are all made animal sets of b
UNO [17]
The main difference between the organisms are the uses of the appendage and the size and number of certain bones. The human arm is used for a variety of functions while the lizard's and the cat's are used for walking an climbing, the whale's for swimming, the frog's for support and the bird's and the bat's for flying.
8 0
3 years ago
People who have a stroke that
tino4ka555 [31]

Answer:

Communication, aphasia. :)

Explanation:

3 0
2 years ago
Read 2 more answers
CO2 enters and O2 escapes from a leaf via.
lorasvet [3.4K]

Answer is A, stomata.

5 0
3 years ago
Other questions:
  • A botanist is studying the effects of different oomycete species on potato plants. She exposes one set of plants to an oomycete
    10·1 answer
  • The term _____ means that some molecules can pass directly through while other molecules cannot.
    14·1 answer
  • A stroke in the primary motor area has caused don to lose control over his skeletal muscles on the right side of his body. what
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What might a scientist analyze?
    10·1 answer
  • What lab tools are present in the picture?
    5·2 answers
  • Holstein cattle are normally black and white. A su- perb black and white bull, Charlie, was purchased by a farmer for $100,000.
    12·1 answer
  • Will mark brainliest and give thirteen points
    13·1 answer
  • Suppose you have the same mass of water and air. If you want to raise the temperature of water and air from 20°C to 30°C, which
    12·1 answer
  • Which item is a carbon sink?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!