1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
3 years ago
15

The younger layer of rock in the grand canyon are on top of the older layers. which of steno's principle best explains this

Biology
2 answers:
Thepotemich [5.8K]3 years ago
8 0

im 100% sure the answer is principle superposition

hope this helps have a nice day

Bond [772]3 years ago
4 0
The answer is "principles of superposition"
You might be interested in
Which 2 examples may be converted into fossil fuels after being buried under pressure for a long period of time?
krok68 [10]

Answer: -plants  

-animal waste

Explanation:

Fossil fuels are the fuels which are generated after a long time taking geological process over the buried organic matter obtain from dead animals, animal dung and plants. The organic matter remain under the heap of earth crust under intense heat and pressure. The heat and pressure generate fuels which are valuable for the entire society as when they are burned they produce huge amount of thermal energy. These includes the crude oil like petroleum, natural gas and coal.

4 0
2 years ago
Read 2 more answers
What does the chloroplast help plants produce
jeka94

Answer:

Chloroplast, structure within the cells of plants and green algae that is the site of photosynthesis, the process by which light energy is converted to chemical energy, resulting in the production of oxygen and energy-rich organic compounds

4 0
2 years ago
Read 2 more answers
What type of organism uses chitin for structure and support?
Evgen [1.6K]

Answer:

fungi

Explanation:

6 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Proteins are broken down to form ammonia, which is toxic to cells. In which organ of the body is this ammonia converted to the l
vodomira [7]
I think the correct answer from the choices listed above is option A. It is in the liver that ammonia is <span>converted to the less toxic compound urea. Most of the wastes products from the processes in our body goes to the liver. It serves as a filter in our body. Hope this answers the question.</span>
6 0
2 years ago
Read 2 more answers
Other questions:
  • What type of energy transformation takes place when carbon is circled during cellular respiration
    15·2 answers
  • What is the force that moves rock and other materials downhill called?
    11·1 answer
  • Lists 3 characteristics that are used to describe air
    10·2 answers
  • How many oxygen atoms are released into the atmosphere because of the process of<br>photosynthesis?​
    15·2 answers
  • Some people seem more willing to openly display prejudice regarding sexual orientation than prejudice regarding race and gender.
    10·1 answer
  • Who is a supreme being?
    12·2 answers
  • 6. What blood type is shown in the picture?<br> A<br> Rh<br> B
    8·1 answer
  • DNA is often compared to a twisted ladder. In this analogy, what forms the
    15·1 answer
  • Which sport below requires the least cardiovascular fitness?
    10·1 answer
  • If you want to raise a swine, what breed will you choose and why?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!