1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
2 years ago
9

In your own words. Explain the importance of forests and

Biology
1 answer:
iogann1982 [59]2 years ago
7 0

Answer:

The importance of Forests

Explanation:

Forests is important because it is the first and foremost means to effective climatic change which w all depend upon. It also provides us with enormous amount of food and oxygen for survival.

This leads to the importance of forest conservation effort towards sustaining the climate again changes that are harmful to human existence. It also explains the need to conserve the forest as source of fuel, food and medicine among others.

Some of the particular threats to forest in my areas include excess deforestation and the governments effort to plant a tree advocacy and other forms of re-orientation programmes to educate people against consistent hunting that reduces forest life.

You might be interested in
Police Officer Amy Randall suspects that the driver of a car in front of her is driving under the influence of alcohol. She pull
Umnica [9.8K]

Answer:

The correct answer is option a, that is, cerebellum.

Explanation:

Alcohol acts as a CNS depressant. When more amount of alcohol is taken and the levels of alcohol rise within the body, some sections of the brain get influenced and a reduction in the functioning is witnessed in that particular part.  

The region of the brain accountable for coordinating movement and also some kinds of learning seems to be sensitive specifically to the consumption of alcohol. Thus, cerebellum is the part of the brain, which gets most affected due to the consumption of alcohol. Therefore, test is performed to witness the balance of an individual, as cerebellum is the part of the brain responsible for appropriate posture and balance.  

5 0
3 years ago
What power source is the best in order to comply with city restrictions
Goshia [24]
Electricity because most cities use electricity. and a generator would be to loud in a city
3 0
3 years ago
How does comparative anatomy support the idea that organisms share ancestors?
REY [17]
When you compare different organisms and see that they have the same or similar anatomic traits, it's reasonable to assume the organisms share a common ancestor where they would have gotten trait from. (evolution)
6 0
3 years ago
2
jeka57 [31]

Answer:

Either (1.) Fossils or (2) Radiometric dating.

Explanation:

Fossils are an obvious answer to this, but radiometric dating is the method most scientists use to find the age of rocks. Radioactive isotopes break down predictably, so the farther along this process is, the older the rock is.

3 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • Which disease is characterized by the development of a membrane on the tonsils, pharynx, or larynx, leading to respiratory obstr
    9·1 answer
  • Professor Parker suggested that heterosexual adults are genetically predisposed to form monogamous bonds because this practice f
    11·1 answer
  • Patrick is observing a stained slide of muscle tissue under a microscope. He observes alternating dark and light bands inside th
    12·1 answer
  • What is the term for the nucleotide sequences that are removed during mrna processing?
    5·1 answer
  • _____________ are present in an organism, but they don't function in the same way they used to. HELP ILL GIVE BRAINLIEST!!! pict
    12·1 answer
  • Which of the following would NOT be a density-dependent limiting factor?
    9·1 answer
  • If the thread of the kite is broken in the sky,what type of motion will the kite get
    9·1 answer
  • Read a quotation by New York Senator William Marcy. To the victor belong the spoils of the enemy. Based on this quotation, Willi
    10·1 answer
  • Outcome of pancreaticoduodenectomy with pylorus preservation or with antrectomy in the treatment of chronic pancreatitis
    15·1 answer
  • ____________ is often criticized by both heterosexuals and lesbian/gay individuals as indicating promiscuity, indecisiveness, or
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!