Answer:
The correct answer is option a, that is, cerebellum.
Explanation:
Alcohol acts as a CNS depressant. When more amount of alcohol is taken and the levels of alcohol rise within the body, some sections of the brain get influenced and a reduction in the functioning is witnessed in that particular part.
The region of the brain accountable for coordinating movement and also some kinds of learning seems to be sensitive specifically to the consumption of alcohol. Thus, cerebellum is the part of the brain, which gets most affected due to the consumption of alcohol. Therefore, test is performed to witness the balance of an individual, as cerebellum is the part of the brain responsible for appropriate posture and balance.
Electricity because most cities use electricity. and a generator would be to loud in a city
When you compare different organisms and see that they have the same or similar anatomic traits, it's reasonable to assume the organisms share a common ancestor where they would have gotten trait from. (evolution)
Answer:
Either (1.) Fossils or (2) Radiometric dating.
Explanation:
Fossils are an obvious answer to this, but radiometric dating is the method most scientists use to find the age of rocks. Radioactive isotopes break down predictably, so the farther along this process is, the older the rock is.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T