1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dangina [55]
3 years ago
4

Which statement describes the Richter scale?

Biology
2 answers:
Semenov [28]3 years ago
3 0

Answer:

It estimates the total energy released from an earthquake

It measures large earthquakes far from the seismograph.

It increases in magnitude as amount of damage increases.

Explanation:

The Richter magnitude scale calculates the magnitude of an earthquake. It uses a seismograph to measure earthquakes far from the seismograph where seismic waves are used to determine the magnitude of an earthquake.

A Richter scale reading of 2.0 is considered not to be dangerous, whereas a reading of between 8.0 and 9.8 is considered a catastrophe and can cause destruction on a massive scale.

A Richter scale can also estimate the total energy released from an earthquake through the measurement of the amplitude of the seismic wave.

Alenkasestr [34]3 years ago
3 0

Answer:

It increases in magnitude as amount of damage increases

Explanation:

Got it right on Edge 2020

You might be interested in
Which statements describe transform boundaries
nataly862011 [7]
Take a picture of the options
5 0
3 years ago
Read 2 more answers
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
Instructions: As you respond to Part A and Part B, follow the directions below.
svet-max [94.6K]

A.

The mitochondria is the site of the aerobic respiration in the eukaryotic organism. The mitochondria uses the glucose and the oxygen molecules to form the carbon dioxide, water and ATP (adenosine triphosphate) molecule.

The equation for the aerobic respiration is given below:

C_{6}H_{12}O_{6}+6O_{2}\rightarrow 6CO_{2} + 6H_{2}O

Glucose + oxygen\rightarrowcarbon dioxide + water

All the reaction takes place in the mitochondria, Hence, the givenb lanks can be filled as follows:

1. glucose

2. oxygen

3. carbon dioxide

4. water

5. ATP

B.

The process shown in the figure is aerobic respiration. In the given figure, the mitochondria is shown, the mitochondria is the site of aerobic respiration. The mitochondria obtain the glucose and the oxygen molecule present in the cytoplasm of the cell. The complete aerobic respiration takes place in three steps glycolysis, Kreb cycle and electron transport. In the glycolysis, the glucose is converted into pyruvate. In the Krebs cycle, the pyruvate is oxidised in acetyl-CoA, which undergoes a sequence of reaction giving out ATP from ADP. In the electron transport chain, the NADH as well as succinate, which is formed in the citric acid cycle or Krebs cycle are oxidized, which provides the energy to power ATP synthase (the enzyme involved in the creation of storage of ATP).

4 0
4 years ago
The introduction describes research into unusual bacteria capable of living in an extremely harsh environment. The introduction
Iteru [2.4K]

Answer:

Basic Research

Explanation:

The initial discovery and analysis of the Lake Vida bacteria allowed them to be classified thereby leading to an understanding of their basic metabolic processes.

Although ,the introductory passage suggested several ways that this could lead to applied research by allowing the development of new products.

Conclusively, the research is a basic in nature because it gave a better understanding of the natural world.

7 0
3 years ago
What is the missing word in this sentence? Millimetres of _____ are the units used to measure blood pressure.
ycow [4]

Answer:

mmHg

Explanation:

8 0
3 years ago
Other questions:
  • Research indicates that preschoolers spend approximately ________ reading on the average day. 15 minutes ? hour 1 hour ? hour
    12·1 answer
  • __________ is a mood disorder that is caused by the body's reaction to low levels of light present in the winter months
    12·1 answer
  • Que es el hipotalamo
    11·1 answer
  • Which term describes the maximum number of individuals an ecosystem can
    9·1 answer
  • What are four types of chemical weathering
    5·1 answer
  • All the following are bite registration materials except
    15·1 answer
  • A few individuals of a lizard species from the mainland are transported to a distant island by riding on floating driftwood. The
    7·1 answer
  • Importance of using hand lens in classification of organisms in biology​
    13·1 answer
  • Euglena will most likely act as consumers when placed in an environment that has
    5·1 answer
  • Suppose all the rabbits are killed by a disease. Explain how the absence of rabbits might affect the numbers of two other organi
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!