Take a picture of the options
Answer:
Explanation:
a. The template strand is:
ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT
The coding strand is
TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA
The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'
b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'
c. N terminus Met-Val-Arg-Ser-Asp C terminus
d. GGAGGA
e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.
A.
The mitochondria is the site of the aerobic respiration in the eukaryotic organism. The mitochondria uses the glucose and the oxygen molecules to form the carbon dioxide, water and ATP (adenosine triphosphate) molecule.
The equation for the aerobic respiration is given below:
Glucose + oxygen
carbon dioxide + water
All the reaction takes place in the mitochondria, Hence, the givenb lanks can be filled as follows:
1. glucose
2. oxygen
3. carbon dioxide
4. water
5. ATP
B.
The process shown in the figure is aerobic respiration. In the given figure, the mitochondria is shown, the mitochondria is the site of aerobic respiration. The mitochondria obtain the glucose and the oxygen molecule present in the cytoplasm of the cell. The complete aerobic respiration takes place in three steps glycolysis, Kreb cycle and electron transport. In the glycolysis, the glucose is converted into pyruvate. In the Krebs cycle, the pyruvate is oxidised in acetyl-CoA, which undergoes a sequence of reaction giving out ATP from ADP. In the electron transport chain, the NADH as well as succinate, which is formed in the citric acid cycle or Krebs cycle are oxidized, which provides the energy to power ATP synthase (the enzyme involved in the creation of storage of ATP).
Answer:
Basic Research
Explanation:
The initial discovery and analysis of the Lake Vida bacteria allowed them to be classified thereby leading to an understanding of their basic metabolic processes.
Although ,the introductory passage suggested several ways that this could lead to applied research by allowing the development of new products.
Conclusively, the research is a basic in nature because it gave a better understanding of the natural world.