1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
15

To avoid such dangerous results, it is important to give a patient compatible blood. Which type of blood can a person with Type

A blood receive? Check all that apply. Type A Type B Type AB Type O
Biology
2 answers:
o-na [289]3 years ago
8 0

A+

A-

O

O-

you can only give:

A+

AB+

Nostrana [21]3 years ago
7 0

Answer:

A blood And

O blood

You might be interested in
What stage of the cell cycle is associated with DNA replication?
lara31 [8.8K]
S phase
M phase (mitosis) is usually followed by cytokinesis. S phase is the period during which DNA replication occurs. The cell grows (more...) The duration of these cell cycle phases varies considerably in different kinds of cells.
4 0
2 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Blank comes in many forms including food and heat
ElenaW [278]
Energy would have to be the correct answer
5 0
3 years ago
The distinction between sensation and perception ______. Group of answer choices
Ratling [72]

<u>Answer</u>:

The distinction between the sensation and perception allows the researchers to distinguish between the information processed by the receptors versus the information processed in the cortex.

<u>Explanation</u>:

The sensation is a process by which the sensory receptors take up the signals or stimuli from its surroundings and send it to the brain through nerves. Whereas, in the process of perception the brain organizes, combines and makes patterns from the given stimuli and gives the response to the particular stimuli accordingly.

Both sensation and perception are connected to each other hence if one doesn’t work then the other automatically stops working.

8 0
3 years ago
How grassland can become like a desert by the action of livestock like cows.
kotykmax [81]
This can be caused by over grazing from the livestock or even wild animals such as rabbits. Rabbits are known to breed very quickly and can destroy an ecosystem with their sheer numbers.
5 0
3 years ago
Other questions:
  • A volleyball player has come into the training room after falling on an outstretched arm at practice and hyperextending her elbo
    6·1 answer
  • The diagram shows three steps in the clotting process.
    12·1 answer
  • Help help <br> (Contrast the growth of plants with Mycorrhizae versus without Mycorrhizae.
    6·1 answer
  • Which of the following will lead to speciation
    14·2 answers
  • 11. Countercurrent exchange in the legs of geese
    8·1 answer
  • Name the enlarged swelling at the end of a that is a sensory structure
    12·1 answer
  • Does anyone know the answer<br><br>Thanks​
    6·2 answers
  • Among us private game please join<br><br> 3 imposter<br> the skled<br> and fun please join
    10·1 answer
  • 2. According to the passage, two American scientists found "unexpected static in their radio
    13·1 answer
  • Which animal is one of only two mammals that lay eggs?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!