1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
3 years ago
13

Please help ASAP! I'll give brainliest and 50 points if you have a great answer.

Biology
2 answers:
faust18 [17]3 years ago
4 0

Adaption is where a species adapts to its environment by putting use to certain parts of the body. Almost all organisms must adapt for their environment, when us humans wear a jacket we adapt to the environment by deflecting the cold. The fennec fox has adapted by growing large ears to hear under the desert ground, and claws that are specially designed for digging through the ground to make burrows and hunt subterranean animals.

The movement of matter through the biosphere is different from the flow of energy in that particular area which It is cycled through. Generally, the biosphere is a closed system, so matter remains fairly constant. Energy on the other hand, it enters and leaves the system constantly in the form of sunlight and infrared radiation.

(I know I'm sorry I'm late)...

Hope I help? Brainliest?

rusak2 [61]3 years ago
3 0
What’s the question?
You might be interested in
You played hard in Pe today and didn’t get a chance to rehydrate after class. You fell tired and sluggish. How does your body re
olya-2409 [2.1K]

Answer:

  1. Respiratory system
  2. Nervous system
  3. Circulatory system
  4. Integumentary system
  5. Endocrine system

Explanation:

During excessive hard work or sports, the respiratory system acts to provide sufficient oxygen for energy supply (ATP) - a process takes place in mitochondria. At the very beginning, the respiratory system is active. If the person doesn't intake sufficient water, he will feel tired because of heavy breathing that increases body temperature and affects metabolic reactions. A supply of water would help decrease the respiration need and so support other systems.

The nervous system (hypothalamus) regulates the body temperature which is necessary for metabolic reactions taking place within the body, i.e. homeostasis. During and after exercise, the water intake was not sufficient, this means that the hypothalamus would work to maintain the temperature as well as other metabolic mechanisms. In the case of less water intake, the nervous system would be in stress.

The circulatory system acts to transport blood and oxygen to all parts of the body. During sports activities, the oxygen supply would be high to maintain energy supply. This takes place with the combined action of the circulatory system and respiratory system. For optimal functioning, the circulatory system needs fluids (water) intake because sufficient water is already lost during sports.

The integumentary system is the system that directly protects the body from damages including dehydration. Therefore, in this case, it will be highly active.

The endocrine system consists of glands that produce hormones to control body metabolism. The body metabolism, as mentioned before, is driven through water availability. The reduced water in the body would also put the endocrine system under pressure.

6 0
3 years ago
Which is true about factors that influence
baherus [9]

Answer:

B. The rain shadow effect causes equal

precipitation on both sides of a mountain.

Explanation:

A rain shadow is a patch of land that has been forced to become a desert because mountain ... On the other side of the mountain—the rain shadow side—all that precipitation is blocked. ... This cool air cannot hold moisture as well as warm air. Cool air forms clouds, which drop rain and snow, as it rises up a mountain.

3 0
3 years ago
Fog is a cloud that has.
garik1379 [7]

And red is a color not the word "stop"

7 0
3 years ago
Read 2 more answers
All organisms are made up of cells. These cells are responsible for performing many functions in the body, such as making protei
kodGreya [7K]

Answer:

atp or known as energy

Explanation:

4 0
3 years ago
The image shows a typical practice carried out by members of a society.
tester [92]

Answer:

._.xd

Explanation:

porque si

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which endoplasmic retuculum manufacture lipids and carbohydrates?
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Assume that for a given gene a mutation creates an allele that functions as a dominant negative. The gene codes for a protein th
    7·1 answer
  • Is the Earth an open, closed, or isolated system? Explain.
    11·2 answers
  • How is carbon related to organic matter
    14·2 answers
  • Which population dispersion pattern is most commonly seen in the field for most species?
    5·1 answer
  • In negative feedback the stimulus is (enhanced/reduced). An example of a negative feedback would be if a person had an elevated
    10·1 answer
  • Tran made the timeline below to show the order in which great scientific theories were developed.
    8·2 answers
  • What are 3 major nutrients in eggs?
    14·1 answer
  • In 3–5 sentences, compare and contrast the flow of matter and energy in each
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!