1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
3 years ago
7

What do lung cancer And emphysema have in common

Biology
2 answers:
neonofarm [45]3 years ago
8 0

Answer:

While emphysema and lung cancer are two different conditions, they do share some associations and share the main risk factor for both which is cigarette smoking. Both can lead to immune system malfunction, inflammation, and cell damage which play a role in the development of the two diseases. so they both be come from the cause of smoking

Explanation:

Darina [25.2K]3 years ago
3 0

Answer:

Both are caused by smoking.

Explanation:

You might be interested in
This bonds to cytosine (C) in DNA.
shtirl [24]

Answer: <u>Guanine </u>

According to Chargaff's rule, the base pairing in the DNA and RNA is fixed. Adenine always pairs with Thymine in DNA and Uracil in RNA. Guanine pairs up with cytosine. This complementary base pairing is universal and constant. That's why amounts are also equal. It means if cytosine is 20% in any DNA sample, then amount of guanine would be 20% as well.

4 0
3 years ago
Today, you have learned some basic general information about bacteria that cause infections and bacteria that protect
Lunna [17]

Answer:

Antibiotics killed the bacteria that cause infection but they can also kill beneficial bacteria . thus Ms ABC developed a yeast infection and diarrhea after course of antibiotics because antibiotics distrub natural balance of beneficial bacteria in her intestine.

3 0
3 years ago
Give the 3 products that are formed in the light-dependent reactions.
horrorfan [7]
ATP
NADPH
O2
Are the products formed
8 0
3 years ago
People of all ages were impacted by the expansion and availability of the internet in 1990s. this is an example of what kind of
Karo-lina-s [1.5K]
B. Modernization effect
7 0
3 years ago
14). Clonal selection and differentiation of B cells activated by antigen exposure leads to the production of ________. A) large
Margaret [11]

Answer:

The correct answer is D) short-lived plasma cells that secrete antibodies for the antigen

Explanation:

Each B lymphocyte has an antigen receptor (BCR: B cell receptor), a surface immunoglobulin (IgM or IgD), that binds to specific domains of the antigen called antigenic determinants or epitopes. Only B lymphocytes with a high antibody affinity for the antigen, and which are capable of processing and presenting it, will be positively selected. In this contact between the two cells, an exchange of chemical signals takes place that leads to the activation, clonal proliferation and differentiation of B cells into two sister subclones: one of antibody-secreting plasma cells, and the other of memory primed B cells. Therefore, only these last positively selected B lymphocytes will survive, proliferate and differentiate into plasma cells, synthesizing and secreting antibodies of a single isotypic class, with a unique specificity and high affinity, improving the ability to adhere to the antigen and, thus , neutralize and destroy pathogens.

7 0
3 years ago
Other questions:
  • The information encoded in DNA is used within a cell in a two-stage process. The two stages of this process are called A) replic
    5·1 answer
  • If these organisms were arraigned in a food pyramid, which organism would have the least amount of total energy available?
    9·1 answer
  • The diagram below shows a food web.
    6·2 answers
  • Rivers, springs, and aquifers are all fresh water components of the hydrologic cycle. As this water progresses through the cycle
    15·2 answers
  • What is a real life example of cytoplasm?
    10·1 answer
  • The sequence of in a Dna molecule determines the protein that will be produced
    8·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • CHALLENGE YOURSELF
    13·1 answer
  • PLEASE HELP ASAP THE QUESTION IS IN THE PICTURE
    10·1 answer
  • A type of grass is planted in someone's backyard to look visually appealing but has a toxin that prevents local animals from suc
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!