1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hichkok12 [17]
3 years ago
12

A spinal-epidural, also called a(n) __________ epidural, is a system of administering continuous doses of anesthetic to a woman

who is in labor. it has fewer side effects than traditional anesthesia, and allows for freedom of movement during labor
Biology
1 answer:
Rudik [331]3 years ago
7 0

The epidural anesthesia is a method of pain relief, which is used during the labor pain. It is a well known regional anesthesia. It works by acting as an analgesic, which means a substance that eases the pain, a complete anesthesia or loss of feeling does not occur in the case of epidural anesthesia. It blocks the nerve signals from the lower spinal segments. It is also known as spinal epidural anesthesia or lumbar epidural anesthesia.  

Hence, the black can be filled with lumbar.


You might be interested in
True or False? Only some of our human needs (food, materials, etc.) come from natural resources. *
Misha Larkins [42]

Answer:

false

Explanation:

your body needs a lot on food, materials, etc. from natural resources

3 0
3 years ago
Read 2 more answers
The classification of organisms is called (1 point)​
Inga [223]

Answer:

taxonomy

started by linnaeus

Explanation:

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which organelle is responsible for making lipids and aiding in detoxification of cells?
Vlad [161]
Your answer is A because B and C don't make sense and D is wrong
4 0
3 years ago
Read 2 more answers
The process of biological evolution often allows humans to survive consistent environmental stresses that occur across multiple
dexar [7]

Answer:

The ability to produce sweat to cool their bodies.

Explanation:

Evolution may be defined as the change in the the characteristics of the species with respect to time. The process of the natural selection plays an important role in evolution.

As the humans are living in hot and dry areas, this allow the change in their physiology and genes that help them to survive according to the environment. The humans produce more sweat. They have well developed sweat glands. These glands help in the production of sweat that ultimately causes cooling in their body.  

6 0
3 years ago
Other questions:
  • What is something that a gelatin-like substance that fills the inside of a cell?
    6·1 answer
  • What kind of rock can sandstone be classified as?
    6·2 answers
  • Which of the following could be caused by a decrease in carbon fixation?
    13·2 answers
  • What are parasites when cattle fights them off
    14·1 answer
  • How do chemical tags affect whether a gene<br> gets activated to make a protein, or not?
    14·1 answer
  • PLEASE HELP 1 QUESTION
    5·1 answer
  • Why urination and ejaculation cannot go together?
    6·2 answers
  • Question 5
    11·1 answer
  • Consider this animal cell.<br> A<br> B<br> Н.<br> с<br> D<br> E<br> F.
    13·1 answer
  • What would happen to the rate of respiration if we put the yeast into boiling water to make the yeast suspension
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!