All categories

3 years ago

PLEASE HELP MEE

Biology

2 answers:

forsale [732]3 years ago

7 0

The main type of evidence the scientists used is fossils.
Palaeontologists study plants and animals that existed in the geologic past. To do so, they use fossils and try to determine an organism's evolution and relationship with the environment and other organisms. In this example, palaeontologists used fossils from ancient horses that have gone extinct and try to decipher their evolutionary path. Recognising the evolutionary steps of the ancient horses will make it possible to compare them to the modern horses.

Monica [59]3 years ago

4 0

Scientists decipher the structure of the primitive living system that once existed on Earth with the help of fossil records.

Further Explanation:

Evolution is the phenomenon that occurs continuously on this Earth. Due to the natural selection process, the organism that better fits into the environment and prevails in a particular environment gets selected because factors like their physiological and biochemical process allow them to survive in that particular environment condition.

The evolution can be studied using the phylogenetic tree build by collecting evidence from fossil fuel. Studying biochemistry and genetic data from these records allows the scientist to decipher the lineages and draw the phylogenetic tree from these data. The monophyletic phylogenetic tree can even reveal about the ancestor of modern-day living organism.

Learn More-

1. Learn more about a haploid cell during meiosis brainly.com/question/94813

2. Learn more about how are mitosis and binary fission similar brainly.com/question/6462270

3. Learn more about a dividing eukaryotic cell that is treated with a drug that inhibits the shortening of spindle microtubules. This will cause the cell division cycle to stop at the ____ stage. brainly.com/question/10767798

Answer Details:

Grade: High school

Chapter: Evolution

Subject: Biology

Keywords:

Fossil, living system, Earth, natural selection, organism, environment, physiological and biochemical process, evolution, phylogenetic tree, genetic data, monophyletic phylogenetic tree.

You might be interested in

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago

Viruses are actives only when they are inside a living cell. True False

lesya692 [45]

Answer:

false

Explanation:

8 0

3 years ago

What happens when an atom loses an electron?

MatroZZZ [7]

Answer:

it becomes a positive ion

Explanation:

that is because when it loses an electron, then it has one more proton in comparison with the total number of electrons making it a positive ion

3 0

2 years ago

Read 2 more answers

Number the steps from when a stimulus is received to when the body reacts.

Pachacha [2.7K]

Answer:

1, 5, 3, 4, 2

Explanation: Hope I helped :]

5 0

3 years ago

The f1 generation differed from the f2 in mendel's experiments in that __________. all of the f1 showed the dominant phenotype,

Pavlova-9 [17]

The F1 generation differed from the F2 in the Mendel's experiments in that all the F1 generation showed the dominant phenotype, however only three- fourths or three quarters of the F2 generation did. This is because all the F1 generation were heterozygous and thus the dominant phenotype was expressed, while in the F2 generation there was a mixture of homozygous dominant, homozygous recessive and heterozygous. Therefore, the heterozygotes and the homozygotes dominant showed a dominant phenotype.

4 0

3 years ago