1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
4 years ago
13

True or false? Antacids are substances that behave like acids to neutralize bases

Biology
1 answer:
igomit [66]4 years ago
8 0
The correct answer is true hope this helps! ^0^ :)
You might be interested in
Which of the following statements are true of atp
kolbaska11 [484]
You don't have an answer choice.
5 0
3 years ago
In multicellular organisms, which term tells the highest level of cellular organization?
Blababa [14]

Answer:

organ systems because it contains more cells

plz mrk me brainliest

8 0
3 years ago
Read 2 more answers
How does a system of non living things operate to meet the needs of living organisms in an ecosystem
timurjin [86]
 living things need non living things to survive. Without food, water, and air, living things die. ... Plants use water from the soil, carbon dioxide from the air, and energy from sunlight to make their own food.
6 0
3 years ago
Which of the following is not a characteristic feature of kingdom animalia?
jekas [21]

Answer:

D. they are unicellular

Explanation:

unicellular organisms are not part of the kingdom animalia .Animalia consists of aves(birds),amphibians,reptiles,mammals and so on and all these organisms are multicellular that is having more than one cell.

8 0
3 years ago
HELP!!! Which of the following would have the least impact on primary productivity in the euphotic zone?
lozanna [386]
I think it’s tea because it says that the sunlight is more impacted on the zone


The answer is D
8 0
3 years ago
Other questions:
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • During elongation, RNA polymerase has three prominent channels, or grooves. These channels provide sites for all of the followin
    12·1 answer
  • What are reasons scientists use models?
    12·1 answer
  • An organism feeds off of another, making it weak or causing death. This is an example of
    15·1 answer
  • If a substance weighs 2.00 grams and you need the mass in kilograms, will the number appear to become smaller or larger?
    11·1 answer
  • A group of students are studying the waves generated by an earthquake. They observe that the waves on the seismograph point to a
    12·2 answers
  • A man with blood group B marries with a woman with blood group AB and the daughter has blood group AB. Is this information enoug
    13·1 answer
  • Frederic Griffith used the word transformation to describe the changes in bacteria that he observed. Which is the most useful de
    15·1 answer
  • In which biome is biodiversity most threatened?
    9·2 answers
  • Which is the following is NOT occurring during Interphase?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!