1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andre45 [30]
3 years ago
13

6. What chemical process(es) do producers and consumers

Biology
1 answer:
n200080 [17]3 years ago
3 0

They share cellular respiration. Producers also photosynthesize (or chemosynthesize) and consumers do not.

They share cellular respiration but dint share photosynthesis

You might be interested in
This exocrine gland secretes a substance that is rich in cytoplasm and phospholipids but no other cellular material. What kind o
AnnZ [28]

The correct answer is an apocrine gland.

The apocrine gland is a type of exocrine glands with a specific kind of secretion by membrane budding. The apical portion of the secretory cell of the apocrine gland pinches off, enters the lumen and loses part of its cytoplasm. The example of the apocrine gland is the sweat gland.

6 0
3 years ago
Read 2 more answers
What’s 2 similarities and 2 differences between the Earths layers and the atmospheric layers?
Agata [3.3K]

Answer:

Atmosphere layers. Earth's atmosphere is divided into five main layers: the exosphere, the thermosphere, the mesosphere, the stratosphere and the troposphere. The atmosphere thins out in each higher layer until the gases dissipate in space.

Explanation:

The atmosphere has 4 layers: the troposphere that we live in near the surface of the earth; the stratosphere that houses the ozone layer; the mesosphere, a colder and lower density layer with about 0.1% of the atmosphere; and the thermosphere, the top layer, where the air is hot but very thin.

5 0
4 years ago
If heterozygous tall pea plant is crossed (mated) with another heterozygous tall pea plant,what is the genotype ratio of offspri
WITCHER [35]

Answer:

75%tall 25%short

Explanation:

picture of my work attached

5 0
3 years ago
Read 2 more answers
What role does water play in the creation of peat swamp forests? A) Excess water in the soil causes greater rates of decompositi
tigry1 [53]

Answer:

The correct answer is - option C.

Explanation:

Forest area where the wetland or waterlogged soil does not allow the organic matter (wood and dead leaves) to completely decomposed, known as the peat swamp forest.

waterlogged soil or excess water in the soil decreases the rate of decomposition of the organic matter and allow to form a thick layer of peat over a longer time frame, this peat is acidic in nature.

Enormous regions of the forests are logged at higher rates. This is the manner by which the water helps in making the peat swamp forests.

7 0
3 years ago
How do you thing cystic fibrosis affects other system in the body
irina [24]

Answer:The parts of the body most affected by cystic fibrosis are the sweat glands, respiratory system, digestive system and reproductive system. Cystic fibrosis does not, however, effect the brain and nervous system. A child's ability to learn is not altered by having cystic fibrosis.

Explanation:

8 0
3 years ago
Other questions:
  • Principle of independent assortment two separate chromosomes <br><br> a. True <br><br> b. False
    6·1 answer
  • What type of mRNA requires processing?
    11·1 answer
  • What is the pH range of highly acidic substances?
    7·1 answer
  • Which of the four main sources of water contain salt water? contain fresh water?
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Nitrogen enters the food chain... 1. primarily through soil-dwelling bacteria that "fix" nitrogen by attaching it to other atoms
    14·1 answer
  • ________ cells are involved in fertilization.
    9·1 answer
  • Colorblindness results from
    6·2 answers
  • By definition, if the DNA of a cell undergoes a spontaneous mutation, is was NOT due to _________. Multiple Choice errors in DNA
    14·1 answer
  • Water makes up approximately 60% of the human body and plays a vital role in regulating body temperature. Which property of wate
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!