1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
3 years ago
8

The Thyroid, parathyroid, And thymus are located in the Brain ThroatAbdomen

Biology
2 answers:
Sati [7]3 years ago
8 0

Answer:

Throat.Thyroid plays a major role in metabolism,Thymus plays a vital role in producing white cells which help to fight off disease and. in increasing immunity.Parathyroid is vital in producing calcium.

goldenfox [79]3 years ago
7 0
I think it is in fhe throat
You might be interested in
If water molecules inside and outside of a cell became non polar , how would the transport of materials in and out of the cell b
postnew [5]
<h2>Answer:</h2>

The water will move in and out freely. The material transport which is due to the water transport will be affected.

<h3>Explanation:</h3>
  • Water is a partially polar molecules. Many ionic compounds and ions travel inside and outside the cell due to attachment with water molecule.
  • As well as water movement is controlled due to its polar nature through cell membrane. and the cytoplasm and outer environment is separate due to non polar cell membrane.
  • If the water become non polar then the movement through cell membrane will be easy for water. And the molecules dissolved in water will also be transported uncontrollably.

4 0
3 years ago
Which of the following statements regarding taste and smell is true?
____ [38]
A not true

B not true

C could be true

D not true
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Como se forma un tumor?
elena-s [515]

Question:  

how does a tumor form?

Answer:

En general, los tumores ocurren cuando las células se dividen y se multiplican excesivamente en el cuerpo. Normalmente, el cuerpo controla la división y el crecimiento de las células.

English:  

In general, tumors occur when cells divide and multiply excessively in the body. Normally, the body controls the division and growth of cells.

4 0
3 years ago
Read 2 more answers
What is electromagnetic wave
kykrilka [37]

Answer:

electromagnetic radiation refers to the waves of the electromagnetic field, propagating through space, carrying electromagnetic radiant energy.

3 0
3 years ago
Read 2 more answers
Other questions:
  • When electron pairs are shared among two or more chemical bonds, the molecule is said to have which of the following properties?
    5·1 answer
  • A(n) _______ is an uncontrolled positive feedback loop between cytokines and leucocytes.
    10·1 answer
  • A rose bush is classified in domain _____ and kingdom _______.
    8·1 answer
  • Which is required for the information of sedimentary rock
    7·1 answer
  • To produce transgenic bacteria that make insulin, which of the steps listed below would a scientist do FIRST?
    8·2 answers
  • A old Cell is called what?​
    15·1 answer
  • HELP HELP HELPPP
    8·1 answer
  • What can engineers do to protect ecosystems from invasive species ?<br> will mark brainliest !!!!
    10·2 answers
  • The data table and the cladogram below provide information about the evolutionary history of several different species of animal
    11·1 answer
  • When Sharon purchased her car, she read the car's manual, which included directions on how to change a tire. When she got a flat
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!