1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
coldgirl [10]
3 years ago
5

How have human activities increased atmospheric carbon dioxide levels?

Biology
1 answer:
marissa [1.9K]3 years ago
8 0

Answer:

Human various activities like burning fossils and huge land cover changes contribute to increasing the carbon dioxide of atmosphere.

Explanation:

  • Carbon dioxide level in atmosphere is increasing naturally by organism respiration, decay, volcanoes erupt and carbonated rocks are weathered.
  • Human activities like, urbanization, deforestation, vegetation pattern changes results in changes to reflectivity of earth surface and emmision through burning fossils fuels/forest and cement production are causining an increase in atmospheric carbon di oxide level. When fossils fuel burn the carbon combine with oxygen to form CO2.
  • All these processes ultimately contribute to global warming.

Hoping this might be helpful...!

You might be interested in
PLEASE HELP EHHHHHH );
Nonamiya [84]

Answer:

1

Explanation:

4 0
3 years ago
Read 2 more answers
A 2 L bottle of soda has a volume of 2000 cm³. What is the volume of the bottle in cubic meters?
Svetradugi [14.3K]

Answer:

The answer is

<h2>0.002 cubic meters</h2>

Explanation:

To convert it into m³ we use the following conversion

<h3>1 {cm}^{3}  = 1 \times  {10}^{ - 6}  {m}^{3}</h3>

From the question the value is 2000 cm³

To convert it multiply the value by

1 × 10^- 6m³

That's

<h3>2000 \times 1 \times  {10}^{ - 6}  {m}^{3}</h3>

We have the final answer as

<h3>0.002 cubic meters</h3>

Hope this helps you

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The adult spinal cord ends between the level l1 and l2 of the vertebral column. True or False
viktelen [127]

this is true...........

6 0
3 years ago
Why do you think stop and start codon signals are necessary for protein synthesis.
kolbaska11 [484]

Answer:

because if they dident stop it would malfunction

Explanation:

8 0
3 years ago
Other questions:
  • Although they are different what relationship exists between facts and theories​
    15·2 answers
  • When density increases, the number of molecules in a volume___
    10·2 answers
  • What would become fossils first a fish who died on the ocean floor or a mouse who died on the forest floor
    15·1 answer
  • Wastewater from which source is technically considered graywater, but should be treated as blackwater?(1 point)
    8·2 answers
  • List the four functions of the cell/plasma. membrane.
    14·1 answer
  • Tertiary consumers
    12·1 answer
  • Marianela takes a huge drink of her coffee, assuming that it is at a tolerable temperature, and the heat sears her mouth. Althou
    15·1 answer
  • What is the backbone of DNA composed of (choose all that apply)
    14·2 answers
  • 10
    15·1 answer
  • Which choice describes mitosis?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!