1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ololo11 [35]
3 years ago
13

In pea plants, height is determined by an allele for tallness (T) that is dominant over an allele for shortness (t). What is the

probability that a gamete, selected at random, would carry the short allele (t) in a cross of heterozygous tall pea plants? A. 1/8 B. 1/4 C. 1/2 D. 3/4
Biology
1 answer:
marshall27 [118]3 years ago
3 0
B 1/4 because i seen the question and answer on my test and got it correct
You might be interested in
Since all living things on Earth share the same universal code in DNA and RNA molecules, which of the following is most likely t
Troyanec [42]
All living things have a common ancestor.
6 0
3 years ago
What is a lithospheric plate made of?
skelet666 [1.2K]
The lithosphere is made up of rocks!
4 0
4 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Eukaryotic organisms that are neither fungi, plants, nor animals are members of which kingdom?
natulia [17]
Eukaryotic organisms that are neither fungi, plants, nor animals are members of the Protista <span>kingdom. </span>
6 0
3 years ago
Explain the characteristics of this soil sample that likely allowed Darren to make this identification. Include particle size an
Mekhanik [1.2K]

Answer: Clay, sand and silt characteristics

Explanation:  I found the picture and the rest of your question.

Soil identification as sandy clay

Soil Texture indicates the composition of that soil by which it shows the amount of clay, sand, and silt.

That is a classification instrument and it's used in laboratories to show soil classes. This identification is showing soil class by the characteristics of silt, clay, and sand.

Soil texture can be defined by feel method or hydrometer methods for example.

Characteristics:

  •  0% to 28% of Silt
  •  80% to 45% of Sand
  •  20% to 35% Clay

3 0
3 years ago
Other questions:
  • What are the two specific steps where atp is used in glycolysis?
    9·1 answer
  • Outline THREE uses that cells make of energy released by ATP.
    8·1 answer
  • A group or population that share the same beliefs in a god or gods, have the same sacred literature, and observe similiar ritual
    15·1 answer
  • What was the reaction of the scientific community when Charles Darwin published his theory on Natural selection?
    8·1 answer
  • Typically, the larger organism is unaware of, and unaffected by, the remora. Which type of interaction occurs between the remora
    8·1 answer
  • The complicated molecules that make up living things usually contain carbon. Why is carbon so important in this molescules?
    5·2 answers
  • Which of the following statements is true?
    6·2 answers
  • What is the protolith for the metamorphic rock quartzite?
    14·1 answer
  • How does human waste impact the water cycle?
    14·1 answer
  • Every day we make choices that can potentially affect our environment. For example, we may toss a plastic drink bottle into the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!