Answer:
The Dog is has much more cells because it's bigger.
Explanation:
when a puppy grows up to be a dog, it gains more cells because it GROWS up and becomes bigger than the puppy's original size.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
the cell goes into osmosis and goes into hypnotic solution
Answer:
B) The chromatids of each chromosome are separated.
One way to reduce water consumption on farms is to use drip irrigation. Drip irrigation is a way of watering the plants in the farm directly to their roots. By this less water are consumed and you are sure that the plant really received the amount of water that they need.