1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Makovka662 [10]
3 years ago
15

Variation in a trait is a required condition for natural selection to act on a population for that trait. Assuming a population

of organisms started with only one form of a trait, what are two ways variation in the trait could be introduced into the population? Explain your answer.
Biology
1 answer:
iVinArrow [24]3 years ago
7 0

Answer:

1. Mutation

2. Epigenetics

Explanation:

1. Mutation occurs when there is a change in an organism's DNA sequence as a result of mistakes in DNA replication or as a result of environmental factors like smoking. The mutation in a single organism can be passed on to other generations hence causing a genetic variation in the population, this obeys the Darwin's law that inherited traits (genetic) are passed on to other generations

2. Epigenetics are changes in gene expression that doesn't involve changes in the DNA sequences unlike mutation. This changes can be passed on to other generations and hence cause a variation in the population. This obeys the Lamarckian evolution that acquired traits are passed on to other generations.

A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors such as UV light and cigarette smoke.

You might be interested in
The cells of a puppy and the cells of a dog are the same size. Why is a dog larger?
Crazy boy [7]

Answer:

The Dog is has much more cells because it's bigger.

Explanation:

when a puppy grows up to be a dog, it gains more cells because it GROWS up and becomes bigger than the puppy's original size.

7 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What is happening when the cells start to swell up with water
alekssr [168]

the cell goes into osmosis and goes into hypnotic solution


7 0
3 years ago
Read 2 more answers
Which of the following occurs during mitosis but
marissa [1.9K]

Answer:

B) The chromatids of each chromosome are separated.

3 0
2 years ago
One way to reduce water consumption on farms is to
S_A_V [24]
One way to reduce water consumption on farms is to use drip irrigation. Drip irrigation is a way of watering the plants in the farm directly to their roots. By this less water are consumed and you are sure that the plant really received the amount of water that they need.
4 0
2 years ago
Read 2 more answers
Other questions:
  • True or false all lipids are solid at room temperature
    15·2 answers
  • 1. Do you think this wing is from the left side or the right side of the chicken’s body? Explain your answer.
    6·1 answer
  • In a stringed musical instrument, the sound frequency of a particular string can be increased by
    12·2 answers
  • If you have inherited the talent to play the piano, you can play the instrument really well without much practice.
    12·1 answer
  • Which of the following statements about enzyme function is true? A. Enzyme function is independent of physical and chemical envi
    8·1 answer
  • What is causing the increase in temperature? more oxygen or more carbon dioxide
    9·2 answers
  • Describe the picture​
    9·1 answer
  • Which trait is shared by all prokaryotes and eukaryotes?
    10·1 answer
  • List the phases of mitosis and what happens during each phase.
    14·1 answer
  • Staphylococcus aureus, or staph, is a bacteria that is commonly found in the nose and on the skin of humans. While it is typical
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!