Answer: A variety of substances will dissolve oil, including gasoline and carbon tetrachloride -- both of which have non-polar molecules. Acetone is a special class of solvent called “dipolar aprotic” that, depending on the circumstances, can act as a weak acid or base; it dissolves oil and mixes with water as well.
Explanation:
Deoxyribonucleic acid (DNA) is the hereditary material that lies within the nucleus of all cells in humans and other living organisms. Most of the DNA is placed within the nucleus and is called nuclear DNA.
A chromosome is made up of two chromatids which are joined by the centromere. The chromatids separate from each other during mitosis to form two new chromosomes. The DNA making up a chromosome is dispersed as chromatin.
Under a microscope, chromatids look like little dots and chromosomes are lines.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: