1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
11

Electrons are brought to the electron transport system by the oxidation of

Biology
1 answer:
Viefleur [7K]3 years ago
5 0

Electrons are brought to the electron transport system by the oxidation of NADH and FADH2.

The electron transport chain is a group of proteins located within the inner membrane of the mitochondria which transport electrons. Electrons are passed from one member of the transport chain to another in a series of redox reactions, forming a proton gradient which is then used for ATP production.

NADH and FADH2 are reduced electron carriers which are oxidized into NAD+ and FAD near the beginning of the electron transport chain.


You might be interested in
DNA in the nucleus carries the genetic code for making proteins in ribosomes. The diagram shows a model of DNA. Which part of th
katovenus [111]
The answer is D
The nitrogen bases adenine, thymine, cytosine and guanine code for the amino acid sequence in the protein
3 0
3 years ago
Read 2 more answers
One should inhale when muscles are relaxed and exhale when initiating the lifting or push-off action in resistance training.
Lynna [10]
If this is a true or false question, then the answer is true.
8 0
2 years ago
Read 2 more answers
MUST BE at least 350 WORDS 50 POINTS
Alona [7]

Answer:

Sickle cell disease (SCD) affects millions of people around the globe and is the 4th leading cause of deaths in children in many developing countries. It causes a number of health problems, such as attacks of pain, anaemia, swelling in the hands and feet, bacterial infections and stroke. Sickle-cell contributes to a low life expectancy in the developed world of 40 to 60 years.  

The disease results in abnormal haemoglobin - the oxygen-carrying protein found in red blood cells – giving the blood cell a rigid, sticky, sickle-like shape that hinders its oxygen-binding properties. These irregularly shaped cells can get stuck in small blood vessels, which can slow or block blood flow and oxygen to parts of the body. A blood and bone marrow transplant is currently the only cure for sickle cell disease, but only a small number of patients are eligible. For the rest, there's no cure but effective treatments can relieve pain, help prevent problems associated with the disease and prolong life.

70 years ago, researchers found a genetic connection to the anatomical abnormalities seen in blood cells. A mutation seemed to be causing the moon-shaped blood cells. The most severe form of the disease occurs when two copies of the mutation are inherited. However, patients with one sickle cell gene, referred to as sickle cell trait, usually do not have any of the signs of the disease and live a normal life, but they can pass the trait on to their children.

As with all inherited genetic diseases, you’d expect natural selection to weed out a gene that has such unpleasant consequences but with sickle cell disease, that doesn’t seem to be the case. Indeed, as of 2015, about 4.4 million people have sickle cell disease, while an additional 43 million have sickle cell trait. So what makes the disease stay in the human population?

Researchers found the answer by looking at where the disease was most prevalent. As it turns out, 80% of sickle cell disease cases occur in Sub-Saharan Africa or amongst populations having their ancestors in this region, as well as in other parts of the world where malaria is or was common. There was a long standing theory that the sickle cell trait – having only one sickle cell gene – didn’t cause discomfort and provided a bonus trait of preventing patients from contracting severe forms of malaria. Later confirmed - associating sickle cell to a 29% reduction in malaria incidence - this working theory would explain why the mutation stuck around in evolution. In 2011, researchers used mice to confirm the assumption.

Miguel Soares and Ana Ferreira of the Gulbenkian Institute of Science in Oeiras, Portugal, and colleagues found that haem – a component of haemoglobin – is present in a free form in the blood of mice with sickle cell trait, but largely absent from normal mice. By injecting haem into the blood of normal mice before infecting them with malaria, researchers found it could help guard against malaria. The mice did not develop the disease. Their results also showed that the gene does not protect against infection by the malaria parasite, but prevents the disease taking hold after the animal has been infected.

Explanation:

Sorry if I did or got anything wrong:(

I actually tried on this tho:)

3 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Is paramecium a unicellular or multicellular organism
Ksivusya [100]
<h2>Answer:</h2>

Paramecium is the single celled organism (unicellular).

<h3>Explanation:</h3>
  • An organism which contain only one cell is known as unicellular organism.
  • Paramecium is the unicellular parasite. It can move and digest food.
  • In its structure there are food vacuoles for the digestion of food.
  • Paramecium is the eukaryotic organism because it has a well organised cell with distinct nuclear membrane.
  • It belongs to kingdom protista.
5 0
3 years ago
Other questions:
  • What can wind erosion be reduced by
    10·1 answer
  • The inflammatory response can cause
    11·1 answer
  • A track begins at 0 meters and has a total distance of 100 meters.juliet starts at the 10-meter mark while practicing for a race
    7·2 answers
  • Helppppp please meee!!!!!
    13·1 answer
  • Mini humans exposing the skin to sunlight or a prolonged period of time results in the production of more pigment by the skins t
    11·1 answer
  • One of the major limitations of the information-processing approach to explaining cognitive development is its use of pragmatism
    13·1 answer
  • What are light absorbing molecules that plants use to gather the suns energy called?​
    12·2 answers
  • Order the atoms involved in cellular respiration from most prevalent to least: Oxygen (O), Carbon (C), Hydrogen (H)
    6·1 answer
  • 2
    5·1 answer
  • All of the chemical reactions that occur in your body do so in what type of environment
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!