1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
12

Fill in the blank with the best possible choice: The GFP gene ___________. Key points are underlined.

Biology
1 answer:
vladimir2022 [97]3 years ago
6 0

hello sir i have no idea what the answer is i just want points

You might be interested in
All the rabbits living in a particular area would be an example of
Crank

Answer:

population

Explanation:

3 0
2 years ago
A population that increases 5 percent every year is said to be experiencing
Nata [24]
<span>They are experiencing Exponential growth</span>
5 0
3 years ago
Read 2 more answers
Briefly describe the chicken experiment. Why is it relevant?
vesna_86 [32]
<span>The chicken experiment serves to explain how behavioral conditioning may be applied to any species. By identifying an appropriate reward for the subject in question, that subject may be taught any physically possible random behavior. Then, if witnessed, the behavior is able to be learned and mimicked by other members of the same or even different species.</span>
7 0
3 years ago
5 points
Snezhnost [94]

Answer:

Uplift.................................

Explanation:

5 0
3 years ago
Read 2 more answers
In any food chain or web, the original source of energy is _______. the sun. Earth. the producers.
AfilCa [17]
The sun because of photosynthesis in plants, then herbivores who eat plants then the carnivores who eat the herbivores who ate the plants.
8 0
3 years ago
Other questions:
  • A 2,500-kg car hits a fence with a force of 400 N, and the collision takes one
    12·1 answer
  • suger syrup can be converted to alcohol , by the application of A.Bacteria B.Fungie C.Algea D.Ameaba
    5·1 answer
  • Viruses are generally considered to be nonliving. Should viroids and prions also be viewed as nonliving? Why or why not?
    13·1 answer
  • Pet owners have abandoned their Burmese pythons in the Everglades. Native species of frogs and reptiles decrease with the introd
    12·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which level of the energy pyramid has the least amount of food
    14·2 answers
  • What is the flu pathogen?????????
    8·2 answers
  • Number of Cell Divisions in Meiosis?<br> A. 1<br><br> B. 2<br><br> C. 3<br><br> D. 4
    12·1 answer
  • Nocturnal animals are important pollinators. What niche do they specifically fill?.
    7·1 answer
  • What is climate?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!