1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helga [31]
3 years ago
7

How can prokaryotic cells affect the health of the human body? Check all that apply.

Biology
2 answers:
IRINA_888 [86]3 years ago
3 0

Answer:

They can be harmful.

Explanation:

Prokaryotes are the organism that do not have nucleus and lacks the membrane bound organelle. Eukaryotes have well defined nucleus and contains the membrane bound organelle.

Th prokaryotes includes the small bacteria and other small organism. The bacteria can cause harmful disease in humans. They can cause cancer or can mutate the genetic constitution of the organisms. The prokaryotes can destroy the products that are harmful and their consumption can destroy the human health.

Thus, the correct answer is option (3).

solmaris [256]3 years ago
3 0

Answer: A. B. C.

Explanation: edgunity

You might be interested in
What is a producer in the desert
Sladkaya [172]
Grasses, shrubs, cacti, and gourd plants.
6 0
3 years ago
What are Sources of thermal pollution
Rina8888 [55]
Heated waste water product from production plants :(, natural gas plants, nuclear plants, textile or paper industries
7 0
3 years ago
Read 2 more answers
How do you think the human body<br> Uses<br> capillary action in the body? Give an example.
MrRissso [65]

Answer:

The vascular system

Explanation:

The human blood circularitory system can be used to explain capillary action in the human body, our heart pumps blood in and out with no use of external forces.

3 0
2 years ago
Most living things need oxygen to survive. You breathe in oxygen and it is carried to this organ. Here the red blood cells pick
Ainat [17]
C) the lungs.
The air moves down the trachea and into the lungs where it is picked up by the blood
3 0
3 years ago
Read 2 more answers
How does a catalyst work? using these options...
Gelneren [198K]

Answer: D) By decreasing the activation energy of a reaction

A catalyst is a substance that speed up the rate of chemical reaction without affecting the product of the reaction. They only affect the rate of reaction not the yield of reaction.

Catalyst provide an alternative reaction pathway that has lower activation energy  than that of uncatalysed reaction. It increases the frequency of collision and because of these greater collision which lowers the activation energy of the reaction.


8 0
3 years ago
Read 2 more answers
Other questions:
  • A good conclusion restates the hypothesis so that the reader
    7·1 answer
  • Nucleotide is to DNA as monosaccharide is to
    6·1 answer
  • Meiosis is a process that produces gametes. Using the diagram, what do you notice about the cells produced in meiosis?
    7·2 answers
  • The diagram magnifies a cross section of the plasma membrane
    12·1 answer
  • Explain the difference between negative growth rate and zero growth rate.​
    15·2 answers
  • In North America, what is the largest biome present?
    9·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Lipids are?
    13·1 answer
  • .
    6·1 answer
  • Anna was successfully done in baking caramel bar. She produced 6 recipes for every recipe, she has 5 boxes of caramel bar. It me
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!