1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
3 years ago
13

The term that describes the need for one hormone to be present for a second hormone to produce a full effect is called ________.

Biology
1 answer:
Nat2105 [25]3 years ago
8 0
Car car car car lksdljfds
You might be interested in
The fusion of two deuterium nuclei requires extreme temperature and _____.
nataly862011 [7]
<span>The answer is A. high pressure. The fusion of two deuterium nuclei can only be done with high temperature and also highpressure to prevent electrostatic repulsion of the proton. The successful combination of the deuterium then creates helium as it all combines.
    Source: Objective Pre-Engineering Physics, Objective Questions with a Glossary of Knowledge wrote by Shobhana Sharma/ Google books </span>
6 0
3 years ago
Read 2 more answers
(a) if the seawater carbonate ion concentration is 270 ?mol/kg, what is the approximate rate of calcification, and approximately
Travka [436]
Using the graph provided with the question, we are able to find that that for a concentration of 270 micromol per kilogram, the calcification rate is 20 mmol calcium carbonate per meter squared per day.

Using this calcification rate,
30 = 20 * 1 * days

days = 1.5

The deposition will require 1.5 days.
7 0
3 years ago
Which of the following provide the most readily available energy?
emmasim [6.3K]
<span>The answer is a. carbohydrates. The amount of potential energy in the molecule depends on the number of C-H bonds in the molecule. Carbohydrates have more C-H bonds. Thus, they can serve as energy storage. Other macromolecules have less C-H bonds. Thus, when energy is needed immediately, complex carbohydrates break down to simple carbohydrates and the energy is released.</span>
3 0
3 years ago
Read 2 more answers
What is the difference between an invertebrate chordate and a vertebrate chordate
erik [133]
Invertebrate doesn't posses "Backbone" whereas Vertebrate chordate have that. That's the only & most important difference between them.

Hope this helps!
4 0
3 years ago
The combined alleles of all the individuals in a population is called the
Yanka [14]
Constatute...........
6 0
3 years ago
Other questions:
  • Which two hormones are consistently related to high levels of aggression?
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Okay so I have this presentation in science and I just have a quick question so my topic is “Ellipse” and I honestly don’t under
    7·1 answer
  • A body cavity that enables animals to grow larger and more complex is called a
    9·1 answer
  • Which are present when freezing rain occurs
    13·2 answers
  • This picture shows some fortified cereal in a bowl.
    9·2 answers
  • 7. Indicate which stage of mitosis is occurring in each of the images above and describe what is
    5·1 answer
  • If frogs are edible, why can't we eat cane toads?
    14·1 answer
  • The site of transcription.
    14·1 answer
  • Water requires a very large amount of energy to undergo a change of state compared to most molecular compounds.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!