1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna11 [192]
3 years ago
14

The site of transcription.

Biology
1 answer:
fgiga [73]3 years ago
4 0

Answer:

it wont let me out of this quistion aaaaaaaaa

Explanation:

oop help me

You might be interested in
Explain how the processes of sea-floor spreading and magnetic reversal produce bands of oceanic crust that have different magnet
WARRIOR [948]

Explanation:

As the two plates move away from each other in a divergent boundary, the magma from the mantle beneath rises to replace the void created. The magma then cools into a new crust. Before the magma cools, the iron minerals align themselves with the magnetic fields of the earth due to their ferromagnetic properties. These cause the rocks after they are cooled to seem to have bands.

Due to magnetic reversals of the earth's magnetic fields (i.e change in magnetic north and south poles) over several hundred thousand years, these bands will orient differently depending on the then earth magnetic polarity when the magma was cooling.

Learn More:

For more on seafloor spreading check out;

brainly.com/question/3616698

LearnWithBrainly

4 0
4 years ago
The chytrid fungus Batrachochytrium dendrobatidis is colonizing frogs across the globe causing massive mortality and even pushin
Elanso [62]

Answer:

Parasitism

Explanation:

Batrachochytrium dendrobatidis is a parasitic chytrid fungus which is responsible for the declining population of amphibians in the rain forests of Panama and Australia.

The fungus grows on the keratinized layer of epidermis on amphibian skin and makes a thick covering of fungus on the amphibian's skin. So as amphibian's skin helps them to maintain the proper osmotic balance in the body so when a thick fungus grows on their skin they are not able to maintain the correct osmotic balance in their body which leads to amphibian death.

So as Batrachochytrium dendrobatidis is a parasitic fungus and gets its nutrition from the frog body and do not kill frog immediately as in predation therefore this relationship can be considered as parasitism.

4 0
3 years ago
Where is the energy in the products of photosynthesis?
Slav-nsk [51]
The plant receives energy from the sun and food sources.
4 0
3 years ago
Predict how doubling the length of the sides of a cube-shaped cell would affect
Minchanka [31]

Answer:

Increasing the size of the cube-shaped cell increases the volume. However, the surface area-to-volume ratio decreases. This means that the simple diffusion would take more time distribute nutrients across the cell (and even in the eliminate waste). It would need bulk transport such as vesicle transport, otherwise cell activities would slow down.

4 0
3 years ago
Sorry I have a slow mind... What word do weather forecasters use to describe water vapor that has gathered in a cloud?
Oliga [24]

Answer:

condensation

Explanation:

Condensation is when the water vapor becomes a cloud

please mark brainliest :)

3 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Spongy bone contains needle like threads of bone known as
    8·1 answer
  • Help.. Psychological drug dependence means that
    10·1 answer
  • Hello please help me answer this! What are 3 similarities of Nucleic acids and Proteins? Thank you so much!
    9·1 answer
  • Which of the following examples of an ecological study involves the ecosystem level of organization? 1. effects of competition o
    13·1 answer
  • According to research presented in the text, one of the most important environmental stimuli for premature babies is:
    9·1 answer
  • A key prediction/implication of evolutionary theory is that:
    11·1 answer
  • TECHNOLOGY DEPENDS ON NATURE AND<br> TECHNOLOGY PROTECTS NATURE
    15·2 answers
  • What are three examples of ways in which biology can help inform everday decisions
    7·1 answer
  • What trend is seen between 11-15 watts?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!