1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
3 years ago
9

The temperature-volume relationship shown in the graph in the lesson represents: 1. an inverse linear function

Biology
2 answers:
lianna [129]3 years ago
8 0
A direct linear function

A direct relationship is linear b/c they go in a straight line.
MatroZZZ [7]3 years ago
5 0

a direct linear function

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Decomposition of plant and animal matter present in soil is largely due to soil microorganism. True or False
Harman [31]
<span>The question says,'decomposition of plants and animal matter present in the soil is largely due to soil micro organism. The statement is true. The soil microbes function by decomposing the organic matter in the soil to the forms usable to plants. The humus produce by these microbes is largely responsible for soil fertility. </span>
8 0
3 years ago
A scientist observes changes in a population of slow-moving animals over time. She hypothesizes that the population may be decre
EastWind [94]
Blank 1- scientific
blank 2- extinct
6 0
3 years ago
Read 2 more answers
In general, biomes in the _______ zone have been changed the most by human activity.
dsp73
Biomes in the temperature zone have been changed the most by human activity.
We can define biomes as the community or group of  animals and plants that are distributed or categorized on the basis of common characteristics of environment they are in, five<span> major types of biomes are aquatic, desert, forest, grassland, and tundra.</span>
7 0
3 years ago
1. What is the difference between external and internal fertilization? *
Andru [333]
Internal fertilization is the process when the syngamy (union of male and female gamete) occurs inside the female body after insemination using copulation. In contrast, External fertilization is the syngamy outside the female body, that is in the outer environment especially in water bodies.
7 0
3 years ago
Other questions:
  • Ribosomes can be found on the surface of the endoplasmic reticulum and suspended in the cytoplasm.
    10·1 answer
  • What are four parts of the nervous system in a frog?
    6·1 answer
  • The density of water is greatest at which of the following temperatures?
    13·1 answer
  • Organisms that rely on other living things for food are called
    7·2 answers
  • design a bacterium that will be genetically engineered. describe what it will do and how it will help the environment
    7·1 answer
  • The MCB operon encodes the following four core proteins: MCB250, MCB251, MCB252 and MCB253. MCB354 is encoded by a separate gene
    8·1 answer
  • In Drosophila, white eyes is caused by a recessive allele (w) located on the X chromosome. The dominant allele (W) produces red
    5·2 answers
  • This tortoise is eating cactus on a sunny day. Is carbon moving into the air, moving
    11·1 answer
  • What is the answer with explaining
    5·1 answer
  • How can bacteria be harmful? Select all that apply.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!