1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
3 years ago
5

What is mitosis and meiosis?

Biology
1 answer:
yuradex [85]3 years ago
5 0

Answer:

There are two types of cell division: mitosis and meiosis. Most of the time when people refer to “cell division,” they mean mitosis, the process of making new body cells. Meiosis is the type of cell division that creates egg and sperm cells. Mitosis is a fundamental process for life. Mitosis is the division of a cell into two daughter cells that are genetically identical to the parent cell. Meiosis is the division of a germ cell into four sex cells (e.g. egg or sperm), each with half the number of chromosomes of the parent cell.  Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells. This process is required to produce egg and sperm cells for sexual reproduction. Meiosis begins with a parent cell that is diploid, meaning it has two copies of each chromosome. Mitosis gives two nuclei, and hence two cells, while meiosis gives four. Mitosis gives identical cells to each other and to the mother cell, while meiosis leads to genetic variation due to crossing over and independent assortment. Mitosis includes one division, while meiosis includes two.

You might be interested in
Which cell structure is correctly paired with its function?
djverab [1.8K]
Which cell structures are correctly paired with their functions? A. Themitochondria<span> produce enzymes, and </span>ribosomes<span> transport them. B. The </span>ribosomes<span> make proteins, and the </span>nucleus<span> stores genetic information. C. The cell membrane makes enzymes, and </span>cytoplasm<span>transports them.</span>
5 0
3 years ago
The diagram shows the development of the oocyte and the follicle during the menstrual cycle. Identify at which stage in the cycl
EleoNora [17]

Answer:

after the oocyte- estrogen levels consistently rise

Mature egg- the progesterone levels are high

Between the ovary and corpus lutem- luteinizing hormone levels are high

Explanation:

3 0
3 years ago
Read 2 more answers
1 v
aliina [53]

Answer: metabolism refers to the functions of an organism

Explanation:

Metabolism is the term for all the biochemical processes in an organism and how they are organised and regulated.

3 0
3 years ago
Discuss the effect of latitude on the intensity and duration of sunlight
seraphim [82]

Answer:

jsjeheheeh

Explanation:

j3j3j3jejej

7 0
3 years ago
Which organisms would share the most characteristicts?
topjm [15]

Answer:

The broadest classifications are by domain and kingdom; the most specific classification is by genus and species. The hierarchical groupings in between include phylum, class, family, and order.

if im wrong then meh

Explanation:

7 0
3 years ago
Other questions:
  • Matter is reused in both the water cycle and the carbon cycle.
    15·1 answer
  • Earth's dynamic processes allow our planet to recycle:
    12·2 answers
  • In pairwise alignment, the process of lining up two sequences to achieve maximum identity include:
    13·1 answer
  • Calcium and phosphate are important parts of the bone matrix because they:
    9·1 answer
  • Similarities between mitosis and meiosis (as many as possible, I really need help)
    5·1 answer
  • What conclusions can you make about the relationship between temperature and pressure
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 8. In list format, identify the following structures: #2, #3, #5, #6, #9,
    10·1 answer
  • ¿Cual de los siguientes solutos que pueden estar presentes en el liquido extracelular es transportado de acuerdo al modelo de me
    7·1 answer
  • EXPERT HELP i'LL GIVE BRAINLIEST: Which TWO phrases best describe vascular tissue in plants?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!