1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lidiya [134]
3 years ago
12

What are some ways that good bacteria helps the ecosystem?

Biology
1 answer:
Aloiza [94]3 years ago
6 0
Well, bacteria is a decomposer

which means it will Break down dead organisms to its lowest component so it could be easier to recycled

not only that, it also convert atmospheric nitrogen so it could be used to maintain soil's fertility

hope this helps
You might be interested in
If a hom.ozygous white horse <img src="https://tex.z-dn.net/?f=C%5EWC%5EW" id="TexFormula1" title="C^WC^W" alt="C^WC^W" align="a
marissa [1.9K]

Answer:

c

Explanation:

looked at the answer when i finished the test and got it wrong lol

4 0
3 years ago
Think of the number of different parasites (species of bacteria, viruses, fungi, flatworm, apicomplexan, etc.) that can attack h
xxMikexx [17]

Answer:

The correct answer will be option-Yes--every species represents a resource that may be exploited by an array of parasites

Explanation:

Parasites are the organism which for survival depends on the resources of the host organism and utilize them to the extent that it could lead to the death of the host.

The interaction between the parasite and host proves harmful to the host but beneficial to the parasite.

A number of parasites exist for human species which can directly harm humans. Similarly, a large number of hosts exist for different species which belongs to another kingdom also like even the bacteria has a parasite called bacteriophage which utilizes the resources of the host.

This indicates that every species has some resources which can prove beneficial to another organism in the response of which they become host to a large number of parasites.

Thus, the selected option is the correct answer.

3 0
3 years ago
Is a goose a primary or secondary consumer?
Andrew [12]

Answer: Primary

Explanation: Primary consumer is what eats the primary producer like plants grass.

7 0
3 years ago
Cuántas cifras significativas tiene la siguiente cifra 9000?
xxMikexx [17]
<h2>Answer: Solo tiene 1</h2>

Explanation:

5 0
3 years ago
Which of the following mutations would most likely be identified as a chromosomal translocation
snow_lady [41]

Answer: Structural chromosomal mutation

Explanation: In translocation, a small piece of chromosome is detached from one chromosome and is attached to another non-homologous chromosome. Translocation can be simple, shift or reciprocal.

Simple translocation involves single break in the chromosome. The broken piece gets attached to the end of the non-homologous chromosome.

In Shift translocation, the broken segment of one chromosome gets inserted interstitially in a non-homologous chromosome.

Segment from one chromosome is exchanged with a segment from another non-homologous chromosome simultaneously in Reciprocal translocation.

6 0
3 years ago
Other questions:
  • A 55 kg person on Earth has the __________mass on the moon.
    15·1 answer
  • What best describes the structure of pepsin?​
    11·1 answer
  • If a food product contained fatty acids and glycerol molecules but no triglycerides, could it be advertised as fat free? Explain
    9·2 answers
  • Secondary circular reaction is characterized by infants' new adaptation and _____.
    5·2 answers
  • What are the similarities between all cells?
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • skelettal remains are found and authorities have no clue who it might be. What would a pathologist be able to tell the authoriti
    5·1 answer
  • Which of the following is true of the water at the bottom of the ocean?
    5·1 answer
  • Hii everyone<br> why lord krishna did not marry to radha​
    6·2 answers
  • What are the biggest misconceptions about sleep paralysis?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!