1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksAgata [21]
3 years ago
6

¿Qué significa que cada receptor responde a un estimulo?

Biology
1 answer:
vitfil [10]3 years ago
8 0

Answer:

comunicación

¿Es esto lo que estás buscando?

You might be interested in
The atomic number of an atom is the number of _________.
bonufazy [111]

Answer:

B

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following human activities would affect the natural cycles on Earth? A. Burning fossil fuels C. Factories giving of
loris [4]
Most likely D. all of the above
7 0
2 years ago
Read 2 more answers
What is the primary mechanism which causes surface currents
Nikolay [14]

Answer:

Surface currents in the ocean are driven by global wind systems that are fueled by energy from the sun. Patterns of surface currents are determined by wind direction, Coriolis forces from the Earth's rotation, and the position of landforms that interact with the currents.

6 0
3 years ago
What is the basis for most ecosystems?
zloy xaker [14]

B. Every ecosystem has weather

3 0
3 years ago
Read 2 more answers
Under which conditions do most types of cells function at optimal levels
Scrat [10]

Explanation:

Cells maintain a constant internal environment; this process called homeostasis, ensures that cells obtain an optimal environment in which they can best function.

The endocrine system involves chemical signalling via the secretion of molecules called hormones into extracellular fluid. They bind to chemical receptors in order to cause specific changes in target cells, these lead to changes in the body's internal environment called homeostasis.

It includes the thyroid, parathyroid, pituitary, pineal and adrenal glands along with other regions. The bone, adipose tissue, heart, pancreas and liver are a few of the regions of the body which show endocrine function. The brain, or control center functions to receive and process the information from the receptor. Effectors receive the control center's command and illicits a response in the form of a feedback loop, that may oppose or enhance the stimulus.

Further Explanation:

During homeostasis the body maintains a constant internal balance in pH, temperature, blood pressure etc. Cells in a multicellular organism become specialized for particular tasks and communicate with one another in order to maintain homeostasis. Within the human body these are known as hormone cascades, where several complex steps occur- the tissues signal to one another with the use of hormones released by the endocrine system. The regulation (increase and decrease) of these secretions is achieved by negative feedback loops, where the release of certain substances during a cascade in turn halts the secretion of hormones at earlier stages.

For example, cells within the human body function at an optimal temperature between 97°F (36.1°C)  and 99°F (37.2°C). This is due to the optimal temperature requirement of the enzymes within the human body, which requires this specific range to obtain activation energy.

Learn more about tissue types at brainly.com/question/8487952

Learn more about homeostasis at brainly.com/question/1601808

#LearnWithBrainly

6 0
2 years ago
Other questions:
  • List the charge mass and location of each of the subatomic particles found within atoms
    5·1 answer
  • What is the life cycle of a low mass star like the sun?
    8·2 answers
  • SCIENCE QUESTION PLEASE HELP!!! URGENT!
    15·1 answer
  • Many scientists support the phenomenon of "obeseogens", industrial pollutants and chemicals found in plastics, food packaging, p
    5·2 answers
  • Which is the second smallest level of organization? W X Y Z
    15·1 answer
  • In which part of a lab report would the following sentence most likely occur?
    13·1 answer
  • If given the following partner stand of DNA, what would be it's complementary strand?
    5·1 answer
  • 2. What is a characteristic of angiosperms?
    13·1 answer
  • Similarity between vestigial structures and homologous structures
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!