1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
12

Why do ecologist make models?

Biology
1 answer:
Maru [420]3 years ago
8 0
Ecologists make models to gain insight into complex phenomena such as the effects of global warming on ecosystems.

hope this helps
You might be interested in
1. Which of the following gases is need by plants?
Diano4ka-milaya [45]
Carbon dioxide because people in other animals exhale carbon dioxide as a waste product. People and other animals need oxygen for plants produce oxygen during an important process called photosynthesis which turns the sun energy into nutrients so carbon dioxide would be the answer.
5 0
3 years ago
Read 2 more answers
How can a calendar year help us to understand the magnitude of geologic time
Marina86 [1]

Answer:

The civil year allows us to have an idea of how long our planet has existed.

Explanation:

Calendar year is the 12-month period that corresponds to 365 days of the year, counting from 1 January to 31 December. Geological time, in turn, refers to the didactic organization of the evolution of planet Earth and the forms of life that inhabit or inhabited it. It is an instrument used by Earth's geologists and scientists to analyze and chronologically categorize (through the concept of a civil year) the natural evolution of the world in which we live, in order to better understand its past.

The civil year allows geological time to expose the number of years and days that planet Earth (and its forms of life) are in existence.

7 0
3 years ago
Que son las biomoleculas
Tema [17]

Answer:

They are large macromolecules

Explanation:

Such as lipids, carbohydrates, proteins, or nucleic acids

7 0
3 years ago
The organization of a cell could be compared to a small city. all of the organelles inside of the cell have a specific purpose t
maxonik [38]
I think the answer is A) policeman

because one of the cell walls functions is to protect the cell and control what enters and what leaves
4 0
3 years ago
Read 2 more answers
Which of the following best describes a benefit of one type of nonrenewable energy?
ehidna [41]
1. <span>Nuclear power does not produce air pollution as other energy sources do.
2. </span><span>Ocean currents bring nutrient-rich water into coastal regions.</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which term describes parts of organisms that have a similar function but not a similar structure?
    15·1 answer
  • Use evidence from your chosen maps to explain how hydrosphere and atmosphere are related
    8·1 answer
  • What structure is located at the throat and regulates metabolism.?
    14·1 answer
  • In the United States, which direction does a continental polar air mass that forms over Canada usually move and why?
    12·1 answer
  • The SI unit for power is
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 12. Atoms can have different numbers of which of the following?
    7·1 answer
  • If waste is to remain hazardous for a long period of time, how can society protect itself from problems as occurred at Love Cana
    5·2 answers
  • Movement of xylem sap from roots to leaves __________.
    14·1 answer
  • Select the correct answer.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!