Why do ecologist make models?

1 answer:

8 0

Ecologists make models to gain insight into complex phenomena such as the effects of global warming on ecosystems.

hope this helps

You might be interested in

Do you have a summative in Grade 9 science?

sukhopar [10]

Answer:

check with your teacher

3 0

3 years ago

Read 2 more answers

Asexual reproduction _____. View Available Hint(s) Asexual reproduction _____. is limited to plants leads to a loss of genetic m

enyata [817]

Explanation:

Asexual reproduction how view Available Hints Asexual reproduction when is limited to planets leads to a loss of genetic material produces offspring genetically.

4 0

3 years ago

The field of psychology is a collection of diverse subfields. Psychologists who conduct ____________ research contribute by expa

serious [3.7K]

Answer:

d. basic; applied

Explanation:

The basic research is a type of research that mainly aims to increase the existing base of the scientific knowledge and hence, in the case of psychology the basic research would increase the knowledge about psychology.
Therefore, the purpose of basic research is to add up to the knowledge that already exists.
The research that is conducted to especially solve certain problems or answer specific questions is called applied research. Its main aim is to find out the solution for a given problem.
Therefore, in the case of psychology applied research is conducted to explore practical problems.

8 0

3 years ago

What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

3 years ago

Read 2 more answers

a three letter sequence of mrna that encordes for a specific amino acid is called a/an a series of these links specific amino ac

Verdich [7]

Answer: Codon

Explanation:

Codon refers to nucleotide triplets of mRNA that serve to specify the amino acid sequence of proteins. There are total 64 genetic code that specify 20 standard amino acids found in proteins. All codon together make genetic code. For example: AUG is codon that specify amino acid "methionine". AUG codon also serve as initiation codon during initiation of protein synthesis.

3 0

4 years ago

Read 2 more answers