Why do unicellular organisms need cell division
1 answer:
You might be interested in
Explanation:
B. serves as the control center of the cell and contains the cell's genetic information
All the genetic information within the eukaryotic cell is stored within the nucleus as helical DNA. This DNA is tightly wounucleuscarbohynd around histones as chromosomes. Chromosomes within the nucleus is unwound, unzipped and read by enzymes in a complex series of steps known as transcription. The message on DNA, called genes is copied by RNA polymerase, to form mRNA complementary sequence to that of the DNA strand. These are then translated into proteins in ribosomes.
Further Explanation:
A cell's structural components (i.e. their makeup) determine their function (what they do) . For instance, photosynthesizing cells in algae and plants have structures called chloroplasts. These contain chlorophyll, a specialized compound which facilitates the conversion of light energy to energy stored in carbohydrates. In specific cell types, collected proteins may function as a unit called an organelle. Some organelles are bound by membranes like those that make up the external structure of the cell, with varying compositions of phospholipids and proteins. These are advantageous, as they:
- may increase metabolic reaction efficiency; they allow cells to concentrates smaller fractions of enzymes and solutes
- separate proteins and molecules that me harm the cell by parceling them into membrane-bound organelles for example, proteaseas bound within lysosomes can break down many structural proteins
Learn more about cellular life at brainly.com/question/11259903
#LearnWithBrainly
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
