1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yKpoI14uk [10]
4 years ago
11

Match the structural formula to the chemical formula for this substance.

Biology
1 answer:
Luda [366]4 years ago
3 0

Answer:

The three dimensional shape or configuration of a molecule is an important characteristic. This shape is dependent on the preferred spatial orientation of covalent bonds to atoms having two or more bonding partners. Three dimensional configurations are best viewed with the aid of models. In order to represent such configurations on a two-dimensional surface (paper, blackboard or screen), we often use perspective drawings in which the direction of a bond is specified by the line connecting the bonded atoms. In most cases the focus of configuration is a carbon atom so the lines specifying bond directions will originate there. As defined in the diagram on the right, a simple straight line represents a bond lying approximately in the surface plane. The two bonds to substituents A in the structure on the left are of this kind. A wedge shaped bond is directed in front of this plane (thick end toward the viewer), as shown by the bond to substituent B; and a hatched bond is directed in back of the plane (away from the viewer), as shown by the bond to substituent D. Some texts and other sources may use

You might be interested in
During fertilization, a __________ and __________ combine to form a __________.
sineoko [7]
During fertilization, a _sperm_ and _egg_ combine to form a _zygote_.

Sperm and egg (gametes) are both haploid, and the fertilized zygote is diploid.
6 0
3 years ago
Neurotransmitters are ________. Group of answer choices chemicals that cross the synaptic gap and bind to receptors on another n
Hoochie [10]

Answer:

chemicals that cross the synaptic gap and bind to receptors on another neuron

found only in the central nervous system (the brain and spinal cord)

Explanation:

Neurotransmitters are defined as the chemicals that is transported from a nerve cell across the synaptic gap to the receptor of another neuron or a target cell such as a gland cell or a muscle cell.

Neurotransmitters are generated in the central nervous system (the brain and spinal cord) and are stored in synaptic vesicles.

"Hence, the correct answer is:

chemicals that cross the synaptic gap and bind to receptors on another neuron

found only in the central nervous system (the brain and spinal cord)".

8 0
4 years ago
Which statement best describes the term symbolism
Nataly_w [17]

Answer:

C.  A writer uses an object to resent significant ideas or qualities.

Explanation:

7 0
3 years ago
What factor determines how often two alleles for a gene will recombine?
EastWind [94]
The physical distance that separates them on the chromosome.
7 0
3 years ago
Which antibiotic is used to treat mrsa and vre infections?
aliina [53]
The antibiotic used to treat MRSA and VRE infections is linezolid.
6 0
4 years ago
Other questions:
  • Many organisms have unusual behaviors or characteristics when compared to similar organisms. For example, spiders are known for
    10·2 answers
  • Describe how cancer cells are different from other cells. Based on that, explain why cancer is so hard to cure.
    6·1 answer
  • The type of learning that involves problem-solving is called _____
    14·2 answers
  • During which type of cell division does each daughter cell contain half the amount of dna as did the cell just prior to cell div
    9·1 answer
  • A number should be rounded up if
    11·1 answer
  • In which phase of the cell cycle do cells grow and synthesize new protiens and organelles
    5·1 answer
  • Imagine disease kills 85 percent of the wolf population. How will it affect the other organisms?
    10·2 answers
  • You are working in a lab with a stable, unreactive element. How many valance electrons does this element have?
    15·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What term refers to the practice of renewing destroyed ecosystems.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!