1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mandarinka [93]
3 years ago
8

PLEASE HELP FAST!!!!!!!!!

Biology
1 answer:
lapo4ka [179]3 years ago
4 0
1. Trenches 
2. Mountain/Volcano formations as well as earthquakes 
3. Earthquakes and tsunamis 
4. It has made formations like the Marianas Trench, The Ring of Fire, and the Haiti earthquake 
You might be interested in
Between a Black father bear (genotype BB) and a Brown mother bear (genotype bb), they had several baby bears.Black fur allele (B
Karolina [17]

Answer:

100% or 1

Explanation:

This question involves a gene coding for fur color in bears. According to the question, black fur allele (B) is dominant over the brown fur allele (b). This means that a bear heterozygous for fur color (Bb) will be phenotypically black.

In this question, a black father bear (genotype BB) and a brown mother bear (genotype bb) were crossed, the baby bears will all have a genotype Bb (see punnet square in the attached image). Since all the offsprings of this cross have genotype Bb, this means that 100% will have black fur.

6 0
3 years ago
What's muscles are affected?PLEASE ANSWER a-c
Ilia_Sergeevich [38]

Answer:

do it in your self hahahahahaa

3 0
3 years ago
Definition: These are parents, parents of parents, etc.
valentina_108 [34]

Answer:

<u><em>Ancestors</em></u>

Explanation:

Ancestors can be described as the persons from which a particular human being originated. In a broader perspective, it is referred to family history of a person. Scientists believe that all organisms on Earth originated from a common ancestor which were the prokaryotes. The prokaryotes with time gave rise to the eukaryotes. Common descent is the phenomenon in which organisms having common ancestors are referred.

7 0
3 years ago
Which consist of sperm cells and egg cells? <br> gametes<br> tetrads<br> diploids<br> chromosomes
motikmotik
The answer is Gametes
7 0
3 years ago
Read 2 more answers
When an experiment shows that two variable are closely related, the
SashulF [63]
I think the answer is A
Hope this helps!!!!!:)
Have a great day!!
4 0
3 years ago
Other questions:
  • What does this difference in time suggest about the location of the two cities?
    8·1 answer
  • A(n) is a sequence of DNA nucleotides that codes for a specific protein or RNA molecule
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 1. Which of the following statements is not true regarding mutations?
    10·1 answer
  • ____is the cells way of converting food molecules into a form useful to the cell.
    7·1 answer
  • 1 point
    14·1 answer
  • What is the definition for polyploidy?
    11·1 answer
  • Which of the following mechanisms is the correct sequence of events that takes place during the plant responses to internal and
    8·1 answer
  • Which cellular transport process is pictured below?
    12·1 answer
  • How might research into new infectious diseases affect people's live?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!